Labshake search
Citations for Illumina :
601 - 650 of 2523 citations for 8 ETHOXYCARBONYL 6 METHOXY 7 METHYL 6H 1 2 5 OXADIAZOLO 4 3 E INDOL 3 IUM 3 OLATE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... RNA libraries were prepared from samples that met the Illumina TruSeq® Stranded Total RNA Sample Preparation Guide (15031048 E) input guidelines using the Illumina TruSeq® Stranded Total (Plant) RNA Sample Preparation kit (Illumina Inc., San Diego, California, USA). For each library preparation ...
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... corresponding to either the Australian or American samples were pooled and run on 7 lanes of the Illumina NextSeq 500 sequencer (Illumina, San Diego, USA) in 75bp paired-end reads mode.
-
bioRxiv - Neuroscience 2019Quote: ... using 2 × 75bp paired-end reads and 2 × 8bp index reads with a 200 cycle kit (Illumina, 20012861). Samples were sequenced at an average of 1.5M reads per cell.
-
bioRxiv - Neuroscience 2019Quote: ... using 2 × 75bp paired-end reads and 2 × 8bp index reads with a 200 cycle kit (Illumina, 20012861). Samples were sequenced at an average of 1.5M reads per cell.
-
bioRxiv - Cancer Biology 2020Quote: ... and loaded at 4 nM into the MiSeq sequencer (Illumina) v3 chemistry kit spiked with 10% PhiX genome ...
-
bioRxiv - Immunology 2023Quote: ... or the NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Microbiology 2019Quote: ... RNA from cultures grown on PM-4-HBA and PM-syringic acid was processed and sequenced at the University of Wisconsin-Madison Biotechnology Center (Illumina HiSeq2500, 1×100 bp, single end). RNA from cultures grown on PM-succinate was processed and sequenced at the U.S ...
-
bioRxiv - Systems Biology 2021Quote: ... S4 reagent cartridge (2×100 bp) (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... ADNI GO/2 participants (Illumina HumanOmniExpress BeadChip), and ADNI3 participants (Illumina Omni 2.5M ...
-
bioRxiv - Microbiology 2020Quote: ... and sequencing (2 × 150 bp, Illumina HiSeq) were performed by Genewiz (South Plainfield ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, catalog No. MS-102-2003) by the University of Michigan Microbial Systems Molecular Biology Laboratory as described previously (14) ...
-
bioRxiv - Microbiology 2021Quote: ... 2) merged triplicates for DC3000 + (Illumina only), 3 ...
-
bioRxiv - Microbiology 2022Quote: ... generating 2 × 300bp paired-end reads (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... and sequenced on 2×150 Miseq (Illumina). Clonal abundances were estimated using a pipeline adapted from 110 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or SMART-Seq™ 2 (Illumina, 20040532), followed by NovaSeq (RIP-seq experiments from Figs ...
-
bioRxiv - Immunology 2023Quote: ... and HiSeq2500 V2 2×150bp (Illumina®) protocols at the “Institut du Cerveau” (ICM ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2.5 µl of each Nextera Index 1 (N7XX) and Nextera Index 2 (N5XX) primers from a Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011). PCR was performed according to the following protocol ...
-
bioRxiv - Genetics 2021Quote: ... Individual sequencing barcodes were added to each sample by amplifying the entire 40 μL elution in a 100 μL Q5 NEBNext reaction with 0.5 μM of TruSeq_Universal_Adapter primer and a reverse primer containing a unique 8 bp index (Illumina_Multiplex, Supplementary Table 14) for sample demultiplexing post-sequencing ...
-
bioRxiv - Immunology 2021Quote: ... 150 µl from the 14 pM pool was loaded into each well of an 8-well strip tube and loaded onto a cBot (Illumina) for cluster generation ...
-
bioRxiv - Genetics 2020Quote: ... Libraries that passed quality checks were then subjected to deep sequencing (8-47 × genome coverage; 19 × mean coverage, 11 × median coverage) by HiSeq 2500 (Illumina) or NovaSeq 6000 platforms (Illumina).
-
bioRxiv - Genetics 2019Quote: ... A subgroup of subjects comprising 48 SA and 48 non-SA were chosen for the pilot genome-wide genotyping assay in Illumina iScan system using the HumanOmni ZhongHua-8 v1.3 DNA Analysis BeadChip Kit (Illumina, Inc.) at the Li Ka Shing Institute of Health Sciences of the Chinese University of Hong Kong ...
-
bioRxiv - Cell Biology 2019Quote: ... RNA samples with a RNA Integrity Number > 8 were used for library preparation using the protocol for the TruSeq Stranded mRNA library kit (Illumina) on the Illumina Neoprep automated microfluidic library prep instrument ...
-
bioRxiv - Molecular Biology 2020Quote: One μg of total RNA of high quality (RIN>8) was used for sequencing with a TruSeq RNA sample preparation kit (Illumina). We here included 99 islet samples in addition to the 89 islet samples and processed them uniformly following the same protocol as described previously (8) ...
-
bioRxiv - Genomics 2021Quote: ... for 4000 cells was performed according to manufacturer’s instructions and the libraries were paired-end sequenced (R1:27, i7-index:8, R2:98) on HiSeq 4000 (Illumina). Preprocessing of scRNA-seq data ...
-
bioRxiv - Neuroscience 2020Quote: ... we used one batch of 20 ng of total photoreceptor (n = 8) RNA and 30 ng for the other three batches (n = 24) according to the manufacturer’s protocol (Illumina Platforms). For generating libraries from RPE samples we used 20 ng of RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 100 μl from the 16 pM pool were loaded into each well of an 8-well strip tube and placed onto a cBot (Illumina) for cluster generation ...
-
bioRxiv - Genomics 2019Quote: ... The Agilent 2100 Bioanalyzer was used to assess RNA quality and only high quality RNA (RIN > 8) was further processed for removal of ribosomal RNA with the Ribo-Zero Magnetic Gold Kit (Human/Mouse/Rat; Illumina). Ribosomal-depleted RNA was used as input for library preparation with Illumina TruSeq V2 RNA prep kit and processed according to the manufacturer’s instruction ...
-
bioRxiv - Genomics 2020Quote: Peripheral blood DNA genotypes were obtained for 238 subjects using Infinium Multi-Ethnic Global-8 Kit (Illumina, San Diego, CA) and processed with GenomeStudio software ...
-
bioRxiv - Genetics 2020Quote: Nextera barcode adapters were added to can1 amplicons and were then minimally PCR amplified (8 cycles) for attachment of Illumina Nextera XT index primers set A (Illumina). After PCR ...
-
bioRxiv - Immunology 2020Quote: ... High-quality RNA (approximately 500 ng; RIN 8) was used for nondirectional paired-end mRNA library preparation (TruSeq Sample Preparation Kit; Illumina).
-
Glycogen Synthase Kinase 3 regulates the genesis of the rare displaced ganglion cell retinal subtypebioRxiv - Neuroscience 2021Quote: ... Stranded RNA-Seq libraries were constructed from 100 ng high-quality total RNA (RIN > 8) using the TruSeq Stranded mRNA Library Preparation Kit (Illumina). Paired-end sequencing of 40 bases length was performed on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3’RNA libraries were prepared by GenoBiRD core facility according to their published method (47) and sequenced on 8 individual runs on a NovaSeq 6000 or HiSeq 2500 Sequencing System (Illumina).
-
bioRxiv - Cell Biology 2022Quote: ... Samples were randomised to avoid batch effects and multiplexed libraries were run on a single lane (8 samples/lane) of the HiSeq 4000 platform (Illumina) to generate 50bp single-end reads ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were randomised to avoid batch effects and multiplexed libraries were run on a single lane (8 samples/lane) of the HiSeq 2500 platform (Illumina) to generate 100bp paired-end reads ...
-
bioRxiv - Microbiology 2023Quote: ... the library was denatured with 0.1 M NaOH to generate single-stranded DNA molecules and loaded into flow cell channels at a concentration of 8 pM and amplified in situ using TruSeq Rapid SR cluster kit (# GD-402-4001, Illumina). Sequencing was performed at 100 cycles on the Illumina HiSeq 4000 according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... Multiplexing was conducted by ligating an 8-base molecular barcode to sequences before 15 cycles of PCR amplification and HiSeq 2500 (Illumina) Rapid Mode library sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... total RNA with a RNA integrity number (RIN) above 8 was used as input using TruSeq Stranded mRNA kit (Cat #: 20020594) from Illumina following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... 150µL from the 14pM pool was loaded into each well of an 8-well strip tube and loaded onto a cBot (Illumina) for cluster generation ...
-
bioRxiv - Molecular Biology 2023Quote: ... one μg of RNA (RIN>8) was used for library preparation with the Illumina Stranded total RNA Prep Ligation with Ribo-Zero Plus kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared and indexed by adapter ligation and PCR (8 cycles) using the TruSeq Nano DNA Library Prep Kit (Illumina) and TruSeq DNA Single Indexes Set A or B (Illumina) ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA samples with an RNA Integrity Number > 8 were used to prepare libraries following the standard protocol for the TruSeq Stranded mRNA library kit (Illumina) on the Illumina Neoprep automated microfluidic library prep instrument ...
-
bioRxiv - Microbiology 2023Quote: ... Indices were added in a second PCR over 8 cycles with unique primer combinations using the Nextera XT Index Kit V2 (Illumina). The samples were pooled and cleaned using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... Paired-end sequencing (300 bp) with a dual 8-bp barcode was performed using MiSeq (Illumina, San Diego, CA, USA). The sequence reads were sorted individually using each barcode.
-
bioRxiv - Cell Biology 2023Quote: ... Sequencing was performed in paired-end mode with an S1 flow cell (28/8/87 cycles) and a NovaSeq 6000 sequencer (Illumina) at the MGX core facility of Montpellier ...
-
bioRxiv - Plant Biology 2023Quote: ... value of 8 was employed for RNA-Seq library construction using the TruSeq Stranded Total RNA Library Prep Plant kit (Illumina). Hisat2 (Kim et al. ...
-
bioRxiv - Genomics 2024Quote: ... since the original data were produced on a different beadchip with respect to the HO and 1240K data (Infinium Omni2.5-8 Illumina beadchip). The results of the first two PCs were visualized in R-4.1.3 (https://www.r-project.org/ ...
-
bioRxiv - Genetics 2019Quote: Genotype information was available for 21,001 NTR participants from 6 different genotyping arrays (Affymetrix 6.0 [N = 8,640], Perlegen-Affymetrix [N = 1,238], Illumina Human Quad Bead 660 [N = 1,439] ...
-
bioRxiv - Cell Biology 2023Quote: ... and 20 μM reverse P7 primers with 6-bp TruSeq indices that are automatically demultiplexed by Illumina software ...