Labshake search
Citations for Illumina :
251 - 300 of 1277 citations for 8 4 ethoxy 3 methoxyphenyl 1 5 diazabicyclo 3.2.1 octane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... 3’RNA libraries were prepared by GenoBiRD core facility according to their published method (47) and sequenced on 8 individual runs on a NovaSeq 6000 or HiSeq 2500 Sequencing System (Illumina).
-
bioRxiv - Cell Biology 2022Quote: ... Samples were randomised to avoid batch effects and multiplexed libraries were run on a single lane (8 samples/lane) of the HiSeq 4000 platform (Illumina) to generate 50bp single-end reads ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were randomised to avoid batch effects and multiplexed libraries were run on a single lane (8 samples/lane) of the HiSeq 2500 platform (Illumina) to generate 100bp paired-end reads ...
-
bioRxiv - Microbiology 2023Quote: ... the library was denatured with 0.1 M NaOH to generate single-stranded DNA molecules and loaded into flow cell channels at a concentration of 8 pM and amplified in situ using TruSeq Rapid SR cluster kit (# GD-402-4001, Illumina). Sequencing was performed at 100 cycles on the Illumina HiSeq 4000 according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... Multiplexing was conducted by ligating an 8-base molecular barcode to sequences before 15 cycles of PCR amplification and HiSeq 2500 (Illumina) Rapid Mode library sequencing ...
-
bioRxiv - Neuroscience 2022Quote: ... total RNA with a RNA integrity number (RIN) above 8 was used as input using TruSeq Stranded mRNA kit (Cat #: 20020594) from Illumina following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... 150µL from the 14pM pool was loaded into each well of an 8-well strip tube and loaded onto a cBot (Illumina) for cluster generation ...
-
bioRxiv - Molecular Biology 2023Quote: ... one μg of RNA (RIN>8) was used for library preparation with the Illumina Stranded total RNA Prep Ligation with Ribo-Zero Plus kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared and indexed by adapter ligation and PCR (8 cycles) using the TruSeq Nano DNA Library Prep Kit (Illumina) and TruSeq DNA Single Indexes Set A or B (Illumina) ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA samples with an RNA Integrity Number > 8 were used to prepare libraries following the standard protocol for the TruSeq Stranded mRNA library kit (Illumina) on the Illumina Neoprep automated microfluidic library prep instrument ...
-
bioRxiv - Microbiology 2023Quote: ... Indices were added in a second PCR over 8 cycles with unique primer combinations using the Nextera XT Index Kit V2 (Illumina). The samples were pooled and cleaned using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2023Quote: ... Paired-end sequencing (300 bp) with a dual 8-bp barcode was performed using MiSeq (Illumina, San Diego, CA, USA). The sequence reads were sorted individually using each barcode.
-
bioRxiv - Cell Biology 2023Quote: ... Sequencing was performed in paired-end mode with an S1 flow cell (28/8/87 cycles) and a NovaSeq 6000 sequencer (Illumina) at the MGX core facility of Montpellier ...
-
bioRxiv - Plant Biology 2023Quote: ... value of 8 was employed for RNA-Seq library construction using the TruSeq Stranded Total RNA Library Prep Plant kit (Illumina). Hisat2 (Kim et al. ...
-
bioRxiv - Genomics 2024Quote: ... since the original data were produced on a different beadchip with respect to the HO and 1240K data (Infinium Omni2.5-8 Illumina beadchip). The results of the first two PCs were visualized in R-4.1.3 (https://www.r-project.org/ ...
-
bioRxiv - Bioengineering 2024Quote: ... with 2 × 151 bp paired-end dual indexed (2 × 8 bp) reads or using the Nextera DNA Flex Library Preparation Kit (20018705; Illumina) on the NovaSeq6000 sequencer (Illumina ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% PhiX control (Illumina, San Diego, CA, USA) along with positive (DNA sample extracted from the healthy gut ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... Genotyping of the VRC cohort and imputation of genetic variants are described in detail elsewhere.55 We interrogated 7,637,921 variants (imputed from 2,783,635 genetic variants with a minor allele frequency ≥ 5%, measured using the Illumina Human Omni 5 BeadChip array, GRCh37) for an association with each of the 166 ToxScan peptides using the penalized quasi-likelihood (PQL ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA expression (RNA-Seq level 3 data) and DNA methylation (Illumina HumanMethylation450 array) data of 33 types of cancers (n=10,528 ...
-
bioRxiv - Genomics 2021Quote: ... Lab 3 sequenced DNA on a NextSeq 550 (Illumina, San Diego, CA, USA), paired-end 2×75 bp ...
-
bioRxiv - Molecular Biology 2020Quote: Create CSV files listing of all 3 sets of barcodes (Illumina, plate, well)
-
bioRxiv - Neuroscience 2023Quote: ... cDNA libraries were prepared using a 3′-Tag-RNA-Seq library kit (Illumina). Sequencing was performed using one lane of a Hi-Seq 4000 platform with pair-end 40 bp reads ...
-
bioRxiv - Genomics 2023Quote: ... and combined with PhiX control (v.3, Illumina Inc, San Diego, CA, USA) at a final concentration of 1% ...
-
bioRxiv - Genomics 2022Quote: ... The library was run across 4 lanes of a NovaSeq (Illumina), multiplexed with other samples.
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA depletion with additional probes recommended by Illumina (Table 4), stranded library preparation (Illumina Ribo-Zero Plus rRNA Depletion w/ Stranded Total RNA) ...
-
bioRxiv - Molecular Biology 2020Quote: ... High-quality RNA (RIN > 8) was used in library preparation for with the Illumina TruSeq stranded protocol (Illumina, San Diego, USA). Libraries were rRNA depleted using the Illumina Ribo Zero kit and sequenced as single read 75 base pair read length (SR75 ...
-
bioRxiv - Genetics 2021Quote: ... were prepared from RNA samples with a RIN (RNA integrity number) above 8 using the strand-specific TruSeq™ RNA-seq library (Illumina), and 150 bp paired-end read sequencing over three lanes of the Illumina HiSeq4000 sequencing platform was performed at the Norwegian Sequencing Centre ...
-
bioRxiv - Microbiology 2019Quote: ... Illumina barcodes and adapters were attached to pooled and purified products in a second PCR (8 cycles) with the Nextera XT Index Kit A and D (Illumina Inc.). Libraries were purified with Agencourt AMPure XP kit (Beckman coulter ...
-
bioRxiv - Immunology 2020Quote: ... The second round PCR (8 cycles, 70°C annealing temperature) was performed using Nextera XT index primers (Illumina, FC-131-2001) which introduce 8 base pair indices on the 5’ and 3’ termini of the amplicon for data demultiplexing of each sample screened ...
-
bioRxiv - Cancer Biology 2020Quote: ... libraries are pooled at 8 samples per lane and sequenced on an Illumina HiSeq 4000 sequencer (Illumina Inc, San Diego, CA) at PE 2×100 cycles ...
-
bioRxiv - Cancer Biology 2019Quote: ... libraries are pooled at 8 samples per lane and sequenced on an Illumina HiSeq 4000 sequencer (Illumina Inc, San Diego, CA) at PE 2×100 cycles ...
-
bioRxiv - Molecular Biology 2020Quote: We performed 8 additional cycles of PCR with Nextera 24-Index kit for indexing before sample pooling (Illumina, FC-121-1011), for which we used 7.5 μl of the above elute as template ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples with RNA Integrity Number (RIN) >8 were subjected TruSeq Poly-A mRNA Library Pro Kit protocol 15031047 RevD (Illumina, USA) to generate indexed cDNA libraries ...
-
bioRxiv - Cell Biology 2020Quote: ... The adapter-ligated library was completed by PCR with Illumina PE primers (8-11 cycles) and the resulting directional cDNA libraries were sequenced for 50 bases in a single-read format (Illumina HiSeq2000) and analyzed with nextpresso (Graña ...
-
bioRxiv - Genomics 2019Quote: ... paired-end mode with R1 67 and R2 8) at 1.8 pM loading concentration with 2.5% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... value of the samples used for library preparation was ≥8 and cDNA libraries were prepared using IlluminaTruSeq Stranded mRNA Sample Prep kit (Illumina, USA) from 4μg of total RNA according to the manufacturers’ instructions ...
-
bioRxiv - Biophysics 2023Quote: ... We performed 8 additional cycles of PCR with Nextera 24-Index kit for indexing before sample pooling (Illumina, FC-121-1011), for which we used 7.5 μl of the elute as template ...
-
bioRxiv - Genomics 2022Quote: ... 500 ng of purified RNA with RNA integrity number (RIN) ≥8 was subsequently used for library preparation with the TruSeq Stranded mRNA library Prep (Illumina, #20020594) and sequenced on the Illumina NextSeq500 system using a paired-end 2×75 bp protocol ...
-
bioRxiv - Genomics 2022Quote: ... the ScriptSeq™ Index PCR Primers (Sets 1 to 4) and the FailSafe™ PCR enzyme system (all sourced from Epicentre®/Illumina® Inc., Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5’ Illumina adapter (used in the Illumina small RNA kit) and a T7 promoter) ...