Labshake search
Citations for Illumina :
151 - 200 of 794 citations for 8 4 Chlorophenylthio guanosine 3' 5' cyclic Monophosphate triethylammonium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Samples with a RIN >8 was outsourced to Novogene for library construction and sequencing (Illumina Platform (PE150)) with 20 M raw reads/sample ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3’ end adenylation per the TruSeq protocol (Illumina, Inc.), libraries were constructed using an Apollo 324 automated library system ...
-
bioRxiv - Molecular Biology 2019Quote: ... v1.5 small RNA 3’ adaptor kit (Illumina FC-102-1009) or by using TruSeq directional small RNA kit (Illumina RS-200-0012) ...
-
bioRxiv - Genomics 2019Quote: ... the sequence 3’ of the indices were bound by Illumina’s Sequencing Primers ...
-
bioRxiv - Plant Biology 2023Quote: ... with the MiSeq reagent kit version 3 (600 cycles; Illumina). The reads were cleaned up using the cutadapt ver ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Genetics 2021Quote: ... 1 µg of high quality total RNA sample (RIN >8) was processed using TruSeq Stranded mRNA kit (Illumina) according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Library preparation of high-quality RNA (RIN >8) was performed using the TruSeq RNA sample preparation kit (Illumina). Raw sequencing data was aligned to human genome B38 ...
-
bioRxiv - Developmental Biology 2019Quote: ... with RIN values > 8 were subjected to Automated TruSeq stranded total RNA with RiboZero Gold library preparation (Illumina). Single-end 50 bp reads were generated with HiSeq2500 ...
-
bioRxiv - Genomics 2020Quote: ... Genome-wide genotyping of 200 ng genomic DNA from the remaining 207 patients was carried out using Infinium HumanOmni2.5-8 v1.2 BeadChip microarrays (Illumina). After completion of the assay ...
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Immunology 2023Quote: ... Sequencing was performed in 3 sequencing unit of NovaSeq 6000 (Illumina) (100-nt-length reads ...
-
bioRxiv - Immunology 2023Quote: The 3’ adapters were ligated according to the TruSeq kit (Illumina) manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... dual-indexed 3’ DGE libraries were prepared using Nextera XT (Illumina) and sequenced to depth on the NovaseqS4 platform with a paired-end read structure (R1 ...
-
bioRxiv - Microbiology 2019Quote: ... which was denatured and run on the MiSeq sequencer at a final concentration of 5 pM alongside a 5 pM PhiX control (Illumina). Raw reads generated by MiSeq were error-corrected and filtered using DADA2 through QIIME2 (https://qiime2.org).38 Filtered reads were clustered de novo into Operational Taxonomic Units (OTUs ...
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2019Quote: ... low call rate (> 5% low quality data [Illumina detection P>1×10−6 ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Developmental Biology 2022Quote: Transposed DNA fragments were purified using the Qiagen MinElute kit and amplified 6-8 cycles using the Nextera (Illumina) PCR primers ...
-
bioRxiv - Neuroscience 2020Quote: ... and sequenced them using PE100 reads and 2 × 8 bp index reads on a Novaseq 6000 Sequencing System (Illumina) aiming for 1 million reads per cell.
-
bioRxiv - Systems Biology 2021Quote: ... Libraries of extracted RNAs whose A260/A280 >1.8 and RIN >8 were built using the Illumina TruSeqTM RNA sample preparation kit (RS-122-2001, Illumina) and sequenced by an illumina HiSeq 2000 system with paired-end 100-bp reads ...
-
bioRxiv - Cell Biology 2019Quote: ... 100 to 200ng of high-quality total RNA sample (RIN >8) was processed using TruSeq Stranded mRNA kit (Illumina) according to manufacturer instructions ...
-
bioRxiv - Genomics 2021Quote: ... The cell pellets were then resuspended in 20 μl, 10 μl, and 8 μl of transposition mix (25 μl 2×TD buffer, 2.5 μl Tn5 (Illumina), 16.5 μl PBS (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 µL was amplified and hybridized on the Infinium MehtylationEPIC BeadChip (EPIC array; Illumina, Inc., San Diego, CA, U.S.A.). All samples were randomized in a balanced manner for sex and Braak stage ...
-
bioRxiv - Immunology 2022Quote: ... 5,000-50.000 cells per experiment were centrifuged 5 minutes at 8°C, and resuspended in 25 µl transposase mixture (12.5 µl Tagmentation DNA buffer, 1 µl Tn5 transposase (Illumina), 10.75 µl nuclease-free water ...
-
bioRxiv - Genomics 2023Quote: ... 8 μl of modified DNA was subjected to methylation analysis on the Illumina Infinium MethylationEPIC BeadChip (Illumina, CA, USA) at UCL Genomics according to the manufacturer’s standard protocol.
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Molecular Biology 2020Quote: ... was performed using the SureCell WTA 3’ library prep kit (Illumina, 20014279) according to manufacturer’s instructions with minor modifications ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using 300-cycle kit (v.3, Illumina, Inc., San Diego, CA, USA) to obtain 150 bp paired-end reads.
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Neuroscience 2021Quote: ... 3′ gene expression libraries were dual-index sequenced using NextSeq 150bp (Illumina) flow cells by the Duke Center for Genomic and Computational Biology Core Facility.
-
bioRxiv - Cell Biology 2021Quote: ... The final constructed 3’- biased single cell libraries were sequenced by Illumina Nextseq500 machine ...
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Immunology 2022Quote: ... and mixed with 3 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96–Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2023Quote: ... or matched the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Microbiology 2023Quote: ... or matching the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Genetics 2023Quote: ... The final constructed 3’-biased single cell libraries were sequenced by Illumina Novaseq6000 machine ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... distributed over 3 lanes of a HiSeq 2500 with v4 chemistry (Illumina). Sequencing was performed by the Next Generation Sequencing Facility at Vienna BioCenter Core Facilities (VBCF) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and loaded at 4 nM into the MiSeq sequencer (Illumina) v3 chemistry kit spiked with 10% PhiX genome ...
-
bioRxiv - Immunology 2023Quote: ... or the NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Genetics 2021Quote: ... Individual sequencing barcodes were added to each sample by amplifying the entire 40 μL elution in a 100 μL Q5 NEBNext reaction with 0.5 μM of TruSeq_Universal_Adapter primer and a reverse primer containing a unique 8 bp index (Illumina_Multiplex, Supplementary Table 14) for sample demultiplexing post-sequencing ...