Labshake search
Citations for Illumina :
101 - 150 of 1275 citations for 7H Pyrazolo 4 3 d pyrimidin 7 one 1 4 dihydro 3 b D ribofuranosyl oxime monohydrochloride 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... and mixed with 3 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96–Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Molecular Biology 2022Quote: ... and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7), with both containing 8N barcodes for multiplexing.
-
bioRxiv - Cancer Biology 2022Quote: ... All of the 3′ and 5′ flowcells were demultiplexed with bcl2fastq (Illumina). FASTQ files were processed with Cell Ranger v7.0.1 (10x Genomics) ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2023Quote: ... or matched the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Microbiology 2023Quote: ... or matching the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Genetics 2023Quote: ... The final constructed 3’-biased single cell libraries were sequenced by Illumina Novaseq6000 machine ...
-
bioRxiv - Developmental Biology 2023Quote: ... distributed over 3 lanes of a HiSeq 2500 with v4 chemistry (Illumina). Sequencing was performed by the Next Generation Sequencing Facility at Vienna BioCenter Core Facilities (VBCF) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and loaded at 4 nM into the MiSeq sequencer (Illumina) v3 chemistry kit spiked with 10% PhiX genome ...
-
bioRxiv - Immunology 2023Quote: ... or the NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Immunology 2023Quote: ... ADT and 3’ Gexp libraries were mixed at the ratio of 1:5 and sequenced on NovaSeq 6000 sequencer (Illumina) with a configuration of 28/8/0/91-bp for cell barcode ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplification was carried out using 3 µl of NMP per sample and adding 1 µl of each dual-indexed (i7 and i5; Illumina) primer ...
-
bioRxiv - Molecular Biology 2024Quote: ... CUT&RUN libraries (10–20 Mio reads per sample and 1/3 of reads for the controls) were sequenced on a NovaSeq 6000 (Illumina) paired end 100 bp at the Deep Sequencing Facility (Max Planck Institute for Immunobiology and Epigenetics ...
-
bioRxiv - Genomics 2023Quote: ... indexed using IDT for Illumina Nextera UD indexes Sets 1–4 (384 Indexes, Cat no: 20043137, Illumina, USA) and products were amplified ...
-
bioRxiv - Immunology 2022Quote: ... All BCR enriched V(D)J libraries were pooled together and sequenced on a NextSeq500 (Illumina) using the same parameters as previously mentioned.
-
bioRxiv - Physiology 2021Quote: ... and the combination of 384 Unique Dual Indexes (Illumina-Set A to D, Ref. 20027213-20027216). Using the Mosquito HV robot ...
-
bioRxiv - Genomics 2023Quote: ... 4 μl of 1 ng amplicon DNA was combined with a mix containing 1 μl of Amplicon Tagment Mix (Illumina, FC- 131-1096) and 5 μl of Tagment DNA Buffer (Illumina ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA expression (RNA-Seq level 3 data) and DNA methylation (Illumina HumanMethylation450 array) data of 33 types of cancers (n=10,528 ...
-
bioRxiv - Genomics 2021Quote: ... Lab 3 sequenced DNA on a NextSeq 550 (Illumina, San Diego, CA, USA), paired-end 2×75 bp ...
-
bioRxiv - Molecular Biology 2020Quote: Create CSV files listing of all 3 sets of barcodes (Illumina, plate, well)
-
bioRxiv - Neuroscience 2023Quote: ... cDNA libraries were prepared using a 3′-Tag-RNA-Seq library kit (Illumina). Sequencing was performed using one lane of a Hi-Seq 4000 platform with pair-end 40 bp reads ...
-
bioRxiv - Genomics 2023Quote: ... and combined with PhiX control (v.3, Illumina Inc, San Diego, CA, USA) at a final concentration of 1% ...
-
bioRxiv - Pathology 2019Quote: ... Amplicons were then indexed using the Nextera XT Index Kit V2 set A and set D (Illumina) and purified again with AMPure XP beads to remove low molecular weight primers and primer-dimer sequences ...
-
bioRxiv - Immunology 2023Quote: ... V(D)J region-enriched libraries were pooled and sequenced using the NovaSeq 6000 Sequencing System (Illumina).
-
bioRxiv - Genomics 2022Quote: ... The library was run across 4 lanes of a NovaSeq (Illumina), multiplexed with other samples.
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA depletion with additional probes recommended by Illumina (Table 4), stranded library preparation (Illumina Ribo-Zero Plus rRNA Depletion w/ Stranded Total RNA) ...
-
bioRxiv - Genomics 2023Quote: ... Libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD for Illumina and UMI Second Strand Synthesis Module for QuantSeq FWD (Illumina, Read 1) from Lexogen (015.96 and 081.96 ...
-
bioRxiv - Systems Biology 2021Quote: ... ADT and V(D)J libraries were sequenced separately on a Next-seq platform (Illumina, San Diego, CA). The sequencing depths are shown in Table S2.
-
bioRxiv - Microbiology 2021Quote: ... The sequencing library was prepared using the Nextera XT V.2 Index Kit (Sets A and D, Illumina) according to the Illumina 16S MiSeq Sequencing Library protocol ...
-
bioRxiv - Genomics 2019Quote: ... RNAseq libraries were constructed using TruSeq Stranded mRNA SamplePrep Guide 150310 47 D protocol (Illumina®, California, U.S.A.). The RNAseq samples have been sequenced in single-end reads (SR ...
-
bioRxiv - Genomics 2021Quote: ... standard Nextera XT Index Kit indexes were used (Sets A to D for up to 384 combinations, Illumina Catalogue No’s FC-131-2001 ...
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing was performed using TruSeq 3000 4000 SBS Kit v.3 (Illumina) on the HiSeq 4000 platform (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was prepared with the QuantSeq 3’ mRNA-Seq Library Prep Kit from Illumina following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Genomics 2019Quote: ... 4 ng ChIP DNA was incubated with transposase (Illumina, Fc-121-1030) for 10’ at 55’C ...
-
bioRxiv - Genomics 2021Quote: ... 3nM libraries were loaded across 4 lanes on the HiSeq 4000 (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 4 out of 49 samples only had microarray genotype data from Illumina Omni2.5 chips ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The final library was diluted to 4 nM using Resuspension Buffer (Illumina). The rest of the library preparation was completed following the Denature and Dilute Libraries Guide for MiniSeq System by Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Cancer Biology 2023Quote: ... pre-treatment and post-treatment/acquired resistant biopsies were obtained from patients receiving various immune checkpoint inhibitor treatments (PD-L1, PD-1, CTLA-4 targeted therapies) for RNA-seq analysis (Illumina HiSeq2500) from formalin fix paraffin embedded samples ...
-
bioRxiv - Immunology 2021Quote: ... diluted and denatured to a final concentration of 1.8nM using the Illumina Denaturing and Diluting libraries for the NextSeq 500 protocol Revision D (Illumina). Cluster generation and 75-bp paired-end ...
-
bioRxiv - Immunology 2020Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A-D (Illumina). Finally ...
-
bioRxiv - Immunology 2022Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A–D (Illumina). Finally ...
-
bioRxiv - Immunology 2022Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A–D (Illumina). Dual-barcoded libraries were pooled and sequenced using Illumina Nextseq 550 platform ...
-
bioRxiv - Immunology 2023Quote: ... HTGTS-V(D)J-seq libraries were sequenced using paired-end 300-bp sequencing on a Mi-Seq (Illumina) machine ...