Labshake search
Citations for Illumina :
351 - 400 of 951 citations for 7H Cyclopenta c pyridin 7 one 5 6 dihydro 3 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... using 300-cycle kit (v.3, Illumina, Inc., San Diego, CA, USA) to obtain 150 bp paired-end reads.
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Neuroscience 2021Quote: ... 3′ gene expression libraries were dual-index sequenced using NextSeq 150bp (Illumina) flow cells by the Duke Center for Genomic and Computational Biology Core Facility.
-
bioRxiv - Cell Biology 2021Quote: ... The final constructed 3’- biased single cell libraries were sequenced by Illumina Nextseq500 machine ...
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Immunology 2022Quote: ... and mixed with 3 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96–Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2023Quote: ... or matched the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Microbiology 2023Quote: ... or matching the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Genetics 2023Quote: ... The final constructed 3’-biased single cell libraries were sequenced by Illumina Novaseq6000 machine ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... distributed over 3 lanes of a HiSeq 2500 with v4 chemistry (Illumina). Sequencing was performed by the Next Generation Sequencing Facility at Vienna BioCenter Core Facilities (VBCF) ...
-
bioRxiv - Plant Biology 2019Quote: ... The Hi-C libraries were sent to the Australian Genome Research Facility (Melbourne, Australia) for sequencing using one lane of 100 bp PE sequencing using a HiSeq2000 (Illumina Inc.).
-
bioRxiv - Plant Biology 2021Quote: One microgram of total RNA was used to generate RNA-seq libraries using TruSeq Stranded mRNA Library Prep Kit (Illumina Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... a total of 2.58 × 108 assembled paired-end reads was obtained as two 33 Gb FastQ files (one file per Illumina-sequence lane). The sequence quality was evaluated by means of the FastQc software (Andrews ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Paired-end sequencing with 150 cycles for each side of the fragments was performed in one lane of the MiSeq® System (Illumina).
-
bioRxiv - Developmental Biology 2021Quote: ... parental DNA was extracted from one individual male and female from tail-fin clip and sequencing library were synthesized with Nextera XT Kit (Illumina, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... The short-read paired-end libraries were sequenced in two independent lanes and the mate-pair library in one lane using the Illumina HiSeq4000 platform (Illumina, USA). The library’s construction and sequencing were performed by Hokkaido System Science Co ...
-
bioRxiv - Genomics 2021Quote: Microarray-derived SNP genotypes were available for 30,499 BSW cattle typed on seven low-density (20k-150k) and one high-density chip (Illumina BovineHD; 777k). Coordinates of the SNP were originally determined according to the ARS-UCD1.2 build ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were then barcoded and pooled into two lanes (eight samples in one and two in another) to generate 100bp paired-end reads on the HiSeq1500 sequencer (Illumina, Inc.).
-
bioRxiv - Neuroscience 2022Quote: ... We pooled up to 12 samples (with different barcodes) in one lane of a flow cell for sequencing (Illumina HiSeq 2500) and used a 150 bp paired-end read configuration ...
-
bioRxiv - Genomics 2022Quote: ... The final Hi-C DNA-Seq library was submitted to Novogene (www.en.novogene.com) for one lane of PE150 Illumina HiSeq X-Ten (Illumina, San Diego, CA, USA) sequencing.
-
bioRxiv - Genomics 2022Quote: ... These products were then used for index PCR using the SI-PCR Primer from the 10X kit for the i5 and one of the small RNA TrueSeq index primers for the i7 (Illumina #15004197).
-
bioRxiv - Evolutionary Biology 2023Quote: ... We then sequenced the entire pooled library on one lane of a NovaSeq6000 SP flowcell (2x150bp; Illumina, Inc. San Diego, CA) at the University of Iowa Institute of Human Genetics.
-
bioRxiv - Genomics 2023Quote: ... Libraries were pooled and sequenced (2x150nt) on one lane of a S1 flowcell on the NovaSeq 6000 (Illumina, San Diego, CA). FastQ files were generated and demultiplexed with the bcl2fastq v2.20 Conversion Software (Illumina).
-
bioRxiv - Genetics 2019Quote: Genotype information was available for 21,001 NTR participants from 6 different genotyping arrays (Affymetrix 6.0 [N = 8,640], Perlegen-Affymetrix [N = 1,238], Illumina Human Quad Bead 660 [N = 1,439] ...
-
bioRxiv - Cell Biology 2023Quote: ... and 20 μM reverse P7 primers with 6-bp TruSeq indices that are automatically demultiplexed by Illumina software ...
-
bioRxiv - Developmental Biology 2022Quote: ... All 6 individual libraries were pooled in equal amount and sequenced with the HiSeq 4000 platoform (Illumina). The RNA-seq data are available under the GEO accession no ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genomics 2019Quote: ... and the Hi-C libraries were paired-end sequenced (HiSeq 2500, Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... The pool was adjusted to 10pM for clustering on C-Bot (Illumina) and then sequenced Paired-End 101 bases using the HiSeq SBS Kit v4 (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% PhiX control (Illumina, San Diego, CA, USA) along with positive (DNA sample extracted from the healthy gut ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: ... with RNA integrity number higher than 7 was used for library preparation using the TruSeq Stranded mRNA Library Preparation Kit (Illumina, San Diego, CA, USA) and sequenced on a NextSEq500 (Illumina) ...
-
bioRxiv - Genomics 2020Quote: ... The pooled library was quality controlled via sequencing at a concentration of 1.7 pM with 35% PhiX on a NextSeq 500 using a mid-output v2 kit (single-end 75 nucleotides, Illumina, San Diego, CA, USA), resulting in an average sequencing depth of 1 million reads ...
-
bioRxiv - Genomics 2020Quote: ... Both re-pooled libraries were then sequenced at a final concentration of 1.7 pM with 25% PhiX on a NextSeq 500 using a high output v2 kit (single-end, 75 nucleotides, Illumina, San Diego, CA, USA), resulting in an average sequencing depth of 9 million reads (range 817 469 – 41.7 million reads).
-
bioRxiv - Plant Biology 2019Quote: ... one DNA library was prepared using the PCR-free TruSeq DNA sample preparation kit following the manufacturer’s instructions (Illumina, San Diego, CA), and sequenced on an Illumina MiSeq instrument (paired-end 2×250bp ...
-
bioRxiv - Cell Biology 2022Quote: ... All four samples underwent 150 base pair (bp) paired-end read sequencing on one lane of an S4 flow cell (Illumina NovaSeq 6000) to a minimum depth of 500 million reads per sample (Source BioScience ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... the two libraries then were pooled with 48 libraries of other projects and subsequently sequenced on 0.09% (L. virgatum) and 0.08% (L. vulgare) of one lane on an Illumina MiSeq system (Illumina, San Diego, California, USA) at the Department of Biochemistry I at the University of Regensburg ...
-
bioRxiv - Genomics 2019Quote: ... as per the manufacturer’s instructions and sequenced on an Illumina NextSeq500 machine with 13 libraries pooled at 1.8 pM using one High Output Kit v2 (Illumina #FC-404-2005) with 75 cycles single-end.
-
bioRxiv - Evolutionary Biology 2022Quote: ... We sent 100 ng to Genome Quebec for paired-end 150bp sequencing on the Illumina HiSeq4000 or the NovaSeqSP 6000 (one library each) following Genome Quebec’s discontinuation of the HiSeq4000 platform (Illumina, San Diego, CA). The NovaSeq sequences the same reads as the HiSeq but at greater read depths ...
-
bioRxiv - Molecular Biology 2023Quote: ... Agilent 2100 Bioanalyzer and ABI Step One Plus Real-Time PCR System were used following the sequencing on the Illumina HiSeqTM4000 system (Illumina, United States). Illumina sequencing was performed at the Beijing Genomics Institute (BGI-Shenzhen ...