Labshake search
Citations for Illumina :
301 - 350 of 1661 citations for 7 METHYLBENZO B NAPHTHO 2 3 D THIOPHENE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing was performed using TruSeq 3000 4000 SBS Kit v.3 (Illumina) on the HiSeq 4000 platform (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was prepared with the QuantSeq 3’ mRNA-Seq Library Prep Kit from Illumina following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Library preparation followed the TruSeq mRNA 2 (Illumina, USA) protocol and libraries were sequenced on an Illumina HiSeq 2500 platform (two lanes of 125 bp paired-end sequencing) ...
-
bioRxiv - Genomics 2021Quote: ... and sequenced with NovaSeq 6000 (2×150 bp) (Illumina). DNA was isolated from paired tumor-normal samples also using the AllPrep DNA/RNA/Protein Mini kit ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and TruSeq RNA Sample Preparation Kit version 2 (Illumina) according to the manufacturers’ protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... and sequencing (HiSeq, 2 × 150bp paired end, Illumina®) were performed by GENEWIZ (South Plainfield ...
-
bioRxiv - Genomics 2022Quote: ... following manufacturer’s recommendations and sequenced by Illumina HiSeq 2×150 cycles run (Illumina Inc., CA, USA).
-
bioRxiv - Genomics 2022Quote: ... refringens positive and negative samples were generated for RNAseq library construction and sequencing using the same protocol as described above and sequenced by Illumina HiSeq 2×150 cycles run (Illumina Inc., CA, USA).
-
bioRxiv - Evolutionary Biology 2020Quote: ... franciscae strain CBS2926T (Illumina, PE 2 x 100 bp) were sequenced and assembled at INRAE Montpellier ...
-
bioRxiv - Developmental Biology 2020Quote: ... 12 million 2×150 bp reads (Illumina Nextseq 500) were sequenced for each library.
-
bioRxiv - Genomics 2020Quote: ... PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina; see Supplementary Table 2) were not processed through hybridization and sequencing ...
-
bioRxiv - Immunology 2022Quote: ... and RNA sequencing (Illumina HiSeq, 2 x 150 bp).
-
bioRxiv - Microbiology 2022Quote: ... by 2×150 Paired End (PE) configuration by Illumina HiSeq ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Developmental Biology 2023Quote: ... read 2 - 91 cycles) performed with Nextseq 500 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... After cluster generation on cBot 2 (Illumina, SanDiego, USA) using the HiSeq 3000/4000 SR Cluster Kit (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... Libraries (2×145 bp Illumina-compatible paired-end reads) were sequenced on a MiSeq® instrument (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA libraries with 2 % spiked-in PhiX control (Illumina) were sequenced at the 100-bp paired end on a P3 flow cell using an Illumina NextSeq2000 instrument at a sequencing depth of ∼80 K reads per cell ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 1 μl of each Nextera XT Index Kit v2 set B or set C barcoding primer (Illumina, Cat# FC-131-2002 or FC-131-2003). These reactions were then incubated at 95°C for 15 minutes ...
-
bioRxiv - Immunology 2021Quote: ... diluted and denatured to a final concentration of 1.8nM using the Illumina Denaturing and Diluting libraries for the NextSeq 500 protocol Revision D (Illumina). Cluster generation and 75-bp paired-end ...
-
bioRxiv - Immunology 2020Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A-D (Illumina). Finally ...
-
bioRxiv - Immunology 2022Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A–D (Illumina). Finally ...
-
bioRxiv - Immunology 2022Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A–D (Illumina). Dual-barcoded libraries were pooled and sequenced using Illumina Nextseq 550 platform ...
-
bioRxiv - Immunology 2023Quote: ... HTGTS-V(D)J-seq libraries were sequenced using paired-end 300-bp sequencing on a Mi-Seq (Illumina) machine ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were sequenced using the MiSeq 2×250 bp and HiSeq 2×150 bp paired-end read technology (Illumina, San Diego, CA, USA) as previously described [78] ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Microbiology 2020Quote: ... 3’ adapter sequences from the Illumina TruSeq Small RNA Library Preparation Kit (Illumina, RS-200) were ligated onto the dsRNA species by mixing together 1 μl of adapter with 1 μg dsRNA in a 6 μl reaction and heated at 70°C for 2 minutes ...
-
bioRxiv - Genomics 2022Quote: ... An “A” base was then added to the 3’ end and the adaptor from Illumina was ligated only to one end of the resultant dsDNA as the other end contained a 5’ overhang introduced by the N9 primer ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by A-tailing and ligation at the 3’ ends with paired-end adaptors (Illumina) with a single “T” base overhang ...
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Biochemistry 2023Quote: ... mRNA libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina). Quality of mRNA libraries was determined using Agilent Tape Station and mRNA was sequenced at 75 bp single read sequencing using NextSeq 500 (Illumina).
-
bioRxiv - Genomics 2022Quote: ... SW-8046-2) from libraries prepared using the Nextera XT DNA kit (Illumina, Inc, San Diego, CA, and sequenced on Illumina HiSeq4000 (2×150 bp). WGS data was obtained from six C ...
-
bioRxiv - Cancer Biology 2022Quote: ... generating 2 × 75 base read pairs or on a NovaSeq 6000 generating 2 × 150 base read pairs using standard settings (Illumina, San Diego, CA, USA). BCL output from the sequencing platform was converted to FASTQ using Illumina’s bcl2fastq tool (versions 2.17 to 2.20 ...
-
bioRxiv - Systems Biology 2019Quote: ... Set D: indices 37–48 (Illumina, RS-200-0048)) (TruSeq Small RNA Library Prep Kit Reference Guide (Illumina, 15004197 Rev.G)) ...
-
bioRxiv - Immunology 2021Quote: ... The cDNA was enriched for V(D)J cDNA using the Human B cell Chromium Single Cell V(D)J Enrichment Kit (Cat#1000016) followed by library construction to add the priming sites used by Illumina sequencers ...
-
bioRxiv - Microbiology 2024Quote: ... Raw genomic reads obtained by Illumina HiSeq 2500 and NovaSeq 6000 (for D. grisea, E. coxiae, Galdieria sp. ACUF 613, M. erythrocladioides, P. aerugineum, and T. oligopyrenoides) and by Illumina HiSeq 2500 and NovaSeq 6000 plus Oxford Nanopore MinION Mk 1B (for R ...
-
bioRxiv - Molecular Biology 2020Quote: ... Sequencing (Illumina HiSeq 2500, 2 × 50 bp paired-end reads) was performed in the MSKCC Integrated Genomics Operation ...
-
bioRxiv - Microbiology 2019Quote: ... using the v2 2×250 base-pair kit (Illumina, Inc.). Positive/negative controls were included for DNA extraction and amplification.
-
bioRxiv - Plant Biology 2020Quote: ... MiSeq 2×250 bp sequencing (Illumina, San Diego, CA, USA) was performed at the University of Florida’s Interdisciplinary Center for Biotechnology Research.
-
bioRxiv - Microbiology 2020Quote: ... and submitted for 2-by 250-bp Miseq sequencing (Illumina) to the DNA Technologies and Expression Analysis Cores at the UC Davis Genome Center (supported by NIH Shared Instrumentation Grant 1S10OD010786-01).
-
bioRxiv - Microbiology 2021Quote: ... with 2 × 150 bp and a MiSeq reagent V2 (Illumina).
-
bioRxiv - Microbiology 2019Quote: ... Illumina MiSeq 2×250bp paired-end sequencing (Illumina V2 chemistry) was performed in the Transcriptome and Genome Analysis Laboratory at the University of Göttingen in accordance with published guidelines (32) ...
-
bioRxiv - Microbiology 2022Quote: ... and further Mi-Seq 2×300 bp paired-end (Illumina) 16S rRNA sequencing of the V3 and V4 regions (23 ...
-
bioRxiv - Plant Biology 2023Quote: ... and paired-end sequenced (2×150bp) with a HiSeq3000 (ILLUMINA).