Labshake search
Citations for Illumina :
101 - 150 of 1667 citations for 7 Fluoro 3 oxo 3 4 dihydroquinoxaline 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Three Distinct Transcriptional Profiles of Monocytes Associate with Disease Activity in SSc PatientsbioRxiv - Genomics 2022Quote: ... Both full-length and 3’ RNA- seq libraries were sequenced on a NextSeq 500 instrument (Illumina) with 5-10 x 106 aligned reads per sample ...
-
bioRxiv - Cancer Biology 2022Quote: ... We diluted the final library to 3 nM concentration and used a HiSeq PE150 sequencer (Illumina) to perform the sequencing.
-
bioRxiv - Cell Biology 2019Quote: ... COX4I2 and 3’ end of ID1 (green fluorescently labelled BAC (RP5-857M17) provided by BlueGnome (Illumina)) and the 20q telomere probe the TelVysion 20q Spectrum Orange (Cat ...
-
bioRxiv - Genomics 2019Quote: ... The sequencing was conducted on the MiSeq reagent v.3 600 cycles (Illumina, San Diego, CA). The four genomes were assembled using ngs_mapper v1.5 ...
-
bioRxiv - Genomics 2021Quote: ... and dual-indexed 3’ digital gene expression (DGE) sequencing libraries were prepared using Nextera XT (Illumina). Libraries were sequenced on a NovaseqS4 or NovaseqS2 with a paired end read structure (R1 ...
-
bioRxiv - Genetics 2020Quote: ... 3 groups in total) and constructed using the Illumina TruSeq Stranded Small RNA Sequencing kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Paired- end single cell 3’ gene expression libraries were sequenced on a Novaseq 6000 System (Illumina) using a NovaSeq S1 flow-cell to a depth of at least 3.5 × 108 reads/timepoint.
-
bioRxiv - Microbiology 2022Quote: ... and 3 μg of the product was processed using the TruSeq RNA Sample Preparation Kit (Illumina). Purification of mRNA was performed using polyT oligo-attached magnetic beads ...
-
bioRxiv - Genomics 2023Quote: scRNA-seq library preparation was performed using 10x Genomics Chromium 3’ single cell library protocol (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... as well as 6 PCR negative control and 3 extraction negatives on a NovaSeq 6000 (Illumina), with 2 Gb requested per sample.
-
bioRxiv - Developmental Biology 2023Quote: ... 3’ RNA-seq (Bulk MARS-seq91,135) libraries were prepared and sequenced on a Novaseq 6000 (Illumina) at the Weizmann Crown Institute for Genomics ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sequencing was performed on a HiSeq 2000 series for 2 × 100 paired end reads with a 7 nucleotide read for indexes using Cycle Sequencing v3 reagents (Illumina). All regions were covered by >200 reads.
-
bioRxiv - Cell Biology 2021Quote: ... Cells were submitted for 10x library preparation for 3’ single cell sequencing on a NovaSeq 6000 (Illumina) at the Cancer Research UK Cambridge Institute ...
-
bioRxiv - Genomics 2021Quote: ... and (3) 134 Gb (~100× depth) chromosome conformation capture sequencing (Hi-C) data (sequenced by Illumina platform).
-
bioRxiv - Cancer Biology 2021Quote: ... then multiplexed 3 libraries per lane and sequenced on the Illumina HiSeq4000 sequencer (Illumina, San Diego, CA) using the 75 bp paired end format.
-
bioRxiv - Plant Biology 2020Quote: ... Libraries were pooled and sequenced with 3 runs on the MiSeq using the reagent kit V2 (Illumina).
-
bioRxiv - Genomics 2019Quote: ... (Large insertions and deletions are defined to be greater than or equal to 3 nts for Illumina data or greater than or equal to 5 nts for PacBio data ...
-
bioRxiv - Microbiology 2022Quote: ... Libraries were pooled at 3 nM and sequenced on a HiSeq X instrument (Illumina, San Diego, CA) to generate 150 bp paired-end reads (Psomagen ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... and gene expression levels were determined using Illumina Human WG6 Expression BeadChip Version 3 arrays (Illumina Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter) and alternating reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 brain regions per mouse using the TruSeq stranded mRNA LT kit (Cat# RS-122-2101, Illumina). These synthetic RNAs cover a range of concentrations ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries from 7 independent SCL-exo experiments were sequenced on 7 lanes of a HiSeq 1500 (Illumina) by the GEH facility (Rennes ...
-
bioRxiv - Genomics 2020Quote: ... sequencing libraries were prepared from 1 ng gDNA using the Nextera XT Library Preparation Kit v.3 (Illumina) and sequenced on the Illumina NextSeq system (paired end 2 x 150 bp insert size) ...
-
bioRxiv - Genomics 2019Quote: ... and reverse transcribed using 25 pmol RT primer (5’-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3’) for TRU-seq barcodes (RP1 primer, Illumina). A portion of the RT product was removed and used for trial amplifications to determine the optimal number of PCR cycles ...
-
bioRxiv - Bioengineering 2021Quote: ... Additional adapters at 5’-end (P5 and SP1) and 3’-end (P7 and SP2) were designed by Illumina for sequencing purpose ...
-
bioRxiv - Cancer Biology 2019Quote: 3’ RNA-seq library was prepared using a standardised protocol followed by sequencing using a HiSeq4000 platform (Illumina) at the Oxford Genomics Centre (Wellcome Trust Centre for Human Genetics ...
-
bioRxiv - Biochemistry 2021Quote: ... PCR products were gel purified in 3% agarose gel and qPCRed (using NEBNext Library Quant Kit for Illumina) to quantify concentration ...
-
bioRxiv - Genomics 2021Quote: ... Single-cell libraries were prepared using the SureCell WTA 3’ Library Prep Kit for the ddSEQ System (Illumina). The quality of the libraries was assessed using the Agilent 2100 Bioanalyzer ...
-
bioRxiv - Neuroscience 2022Quote: ... Gene expression and barcode libraries were prepared in parallel using the Chromium Next GEM Single Cell 3’ Kit v3.1 (10x Genomics) according to manufacturer’s instructions and sequenced in a Novaseq 6000 system (Illumina). A detailed step-by-step protocol can be found on protocols.io ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were prepared using the QuantSeq 3′mRNA-Seq Library Prep Kit-FWD by Illumina (Lexogen, Vienna, Austria), using 500 ng of total RNA ...
-
bioRxiv - Developmental Biology 2024Quote: ... These cells were processed through the Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 (10X Genomics) according to manufacturer’s recommendations and sequenced on Novaseq6000 (Illumina). The data were processed through the CellBender software to decrease contamination by ambient RNA (Fleming et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μg of total RNA samples underwent treatment with the epicenter Ribo-ZeroTM Kit (Illumina, San Diego, USA) to remove rRNA ...
-
bioRxiv - Genetics 2019Quote: ... An average of 39.7 million 2 x 75 bp paired- end reads were generated for each sample on an Illumina NextSeq 500 (Illumina, Carlsbad, CA). FastQC was used to evaluate the quality of the reads ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNAs were prepared using the single cell 3’ Protocol as per manufacturer’s instructions and sequenced on a NextSeq 500 instrument (Illumina) or NovaSeq instrument (Illumina ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing libraries were prepared using the Chromium Single Cell 3’ v2 kit and sequenced on a HiSeq system (Illumina) at Institut Curie NGS facility ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Microbiology 2019Quote: ... Libraries that passed QC (>3 ng/μL) were sequenced using an Illumina HiSeq sequencer (Illumina, San Diego, CA, USA) with the paired-end 150-bp sequencing model based on >5G raw data output per sample.
-
bioRxiv - Microbiology 2020Quote: ... 3 to 12 µl of extracted RNA was depleted of rRNA using Ribo-Zero Gold H/M/R (Illumina) and then reverse-transcribed using random hexamers and SuperScript IV (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2019Quote: ... ScRNA-Seq libraries were prepared using SureCell WTA 3’ Library Prep Kit for the ddSEQ System (Illumina/Bio-Rad) according to manufacturer’s manual ...
-
bioRxiv - Cancer Biology 2021Quote: 3′-scRNAseq was completed using Chromium Next GEM single cell 3′ GEM library and Gel bead Kit v3.1 (10x Genomics) and sequenced using a NextSeq 500 (Illumina) at Genomics Birmingham (University of Birmingham) ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by library preparation according to the manufacturer’s recommendations (Single Cell 3’ V3 assay) and sequencing on a HiSeq4000 instrument (Illumina). Libraries were de-multiplexed ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The full-length cDNA were synthesized using the Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 and sequenced by Illumina HiSeq X Ten platform by Gene Denovo Biotechnology Co ...
-
bioRxiv - Physiology 2022Quote: ... cDNAs were prepared using the single cell 3’ Protocol as per manufacturer’s instructions and sequenced on a NovaSeq 6000 (Illumina) with 26 bases for read1 and 98×8 bases for read2.
-
bioRxiv - Genomics 2019Quote: ... Genotyping was carried out using the Infinium II HumanHap 550K Genotyping BeadChip version 3 (Illumina, San Diego, California USA). Collection and purification of DNA have been described previously (Kayser et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng RNA was prepared with a commercially available kit according to the manufacturer’s instruction (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina ...
-
bioRxiv - Immunology 2020Quote: ... We diluted the final library to 3 nM concentration and used a HiSeq PE150 sequencer (Illumina, San Diego, CA) to perform the sequencing.