Labshake search
Citations for Illumina :
101 - 150 of 1852 citations for 7 Chloro 3 4 dihydro 1H quinolin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... The libraries were sequenced in 1 x 100 +7 manner on HiSeq 2000 platform (Illumina).
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina) were used for construction of complementary DNA libraries and the complementary DNA libraries were sequenced on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 (Illumina) and the HiSeq Rapid SBS Kit v2-HS (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 (Illumina) for the sequencing.
-
bioRxiv - Immunology 2023Quote: ... 2 (Illumina) was the primer source ...
-
bioRxiv - Microbiology 2021Quote: ... 4) DC3000 + B (Illumina only), 5 ...
-
bioRxiv - Immunology 2021Quote: ... Group 4 (French European, Illumina), Group 5 (North American ...
-
bioRxiv - Genomics 2019Quote: ... The library was sequenced on one lane of a rapid v2 flow cell (Illumina) in paired end 2*250nt mode ...
-
bioRxiv - Microbiology 2019Quote: We sequenced the pooled libraries in one lane of the HiSeq 4000 (Illumina, www.illumina.com) with 150 PE chemistry.
-
bioRxiv - Immunology 2021Quote: ... One pooled library containing 26 samples were sequenced on a NextSeq 500 sequencer (Illumina) using paired-end 38-base reads ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... rotundus assembly with at least one shared homozygous (based on aligned Illumina sequencing reads) inactivating mutation ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... in a fraction of one sequencing lane of an HiSeq2000 flowcell v3 (Illumina Inc.) according to standard Illumina operation procedures at Centro Nacional de Análisis Genómico (CNAG).
-
bioRxiv - Molecular Biology 2020Quote: ... One μg of total RNA was reverse transcribed with the partial P7 adapter (Illumina_4N_21T) and dNTPs with the addition of spiked-in azido-nucleotides (AzVTPs ...
-
bioRxiv - Genomics 2021Quote: ... All libraries were sequenced in one sequencing run on NextSeq 500 high-output (Illumina) with 85 bp single-end reads ...
-
Robust Cancer Mutation Detection with Deep Learning Models Derived from Tumor-Normal Sequencing DatabioRxiv - Genomics 2019Quote: ... and the last one was constructed by combining 9 NovaSeq sequencing replicates from Illumina to get a replicate pair with ∼390× coverage ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... One library was prepared for each individual using the TruSeq Stranded mRNA protocol (Illumina) and cDNA was sequenced on an Illumina NovaSeq 6000 to generate an average of 87 million 150 bp paired-end reads per library (Table S1) ...
-
bioRxiv - Genomics 2020Quote: ... The resulting libraries were sequenced with one sample per lane using the NextSeq500 (Illumina; high-output mode ...
-
bioRxiv - Immunology 2021Quote: ... The libraries were multiplexed and sequenced using one flow cell on Novaseq 6000 (Illumina) as 50bp paired-end reads ...
-
bioRxiv - Genomics 2021Quote: ... The pooled final library was sequenced on one to four lanes of HiSeq2000 (Illumina) with 68 base (Y ...
-
bioRxiv - Cancer Biology 2023Quote: ... One barcoded library was prepared per plate using TD buffer and TDE1 enzyme (Illumina) for tagmentation and KAPA HiFi HotStart Ready Mix (Roche ...
-
bioRxiv - Genomics 2023Quote: ... cycle one begins with incorporation of the first nucleotide in Incorporation Mix (Illumina MiSeq), followed by incubation with shaking at 60°C for 3 min ...
-
bioRxiv - Plant Biology 2023Quote: ... one microgram of crosslinked enriched chloroplasts was resuspended in 1X Tn5 reaction buffer (Illumina) and assayed according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... and run in one lane on a flow cell of NovaSeq 6000 SP (Illumina).
-
bioRxiv - Genetics 2023Quote: ... and the libraries were subjected to 1 × 7 bp high-throughput sequencing by NextSeq 500 (Illumina).
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Microbiology 2019Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Microbiology 2021Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Cell Biology 2022Quote: ... version 2 (Illumina) using 10 PCR cycles ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Libraries were sequenced on one lane of a HiSeq4000 (PE 150; Illumina San Diego, California).
-
bioRxiv - Genomics 2019Quote: ... four Illumina libraries were prepared and sequenced on a HiSeq2000: one paired-end library (Illumina TruSeq DNA PCR-free LT Sample Prep kit #15036187 ...
-
bioRxiv - Neuroscience 2020Quote: ... mixed in equimolar ratios and sequenced on one flow cell of NovaSeq S Prime (Illumina).
-
bioRxiv - Molecular Biology 2021Quote: ... Sequencing was carried out on one lane of an Illumina 2500 Hiseq instrument (Illumina Inc.) using 125 cycle chemistry in paired-end (PE ...
-
bioRxiv - Biochemistry 2020Quote: ... The sample was submitted to one channel of Illumina flow cell and sequenced by Illumina Genome Analyzer (GAII ...
-
bioRxiv - Genomics 2021Quote: ... Metagenomic sequencing was performed on one SP lane of the NovaSeq 6000 sequencing system (Illumina) at the Roy J ...
-
bioRxiv - Cancer Biology 2022Quote: ... the library from patient one was sequenced with an Illumina HiSeq 4000 (Illumina, Berlin, Germany) at the DKFZ Genomics and Proteomics Core Facility in Heidelberg and all other libraries were sequenced on an Illumina NovaSeq 6000 (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... the libraries were multiplexed into one pool and sequenced using the Illumina HiSeq2500 instrument (Illumina) at National Institute for Basic Biology in Okazaki ...
-
bioRxiv - Microbiology 2023Quote: ... one nanogram of DNA was fragmented and adapter ligated using the Nextera XT kit (Illumina) and unique 8bp dual-index adapters (IDT ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and the 7 other libraries were single-end sequenced using 50 cycles on a HiSeq2500 sequencer (Illumina) at the IGBMC GenomEast Platform (Illkirch ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Genomic DNA (7 ng) from each sample was first fragmented using a partial Nextera reaction (Illumina, Inc), which also ligates short adapter sequences to the ends of the fragments ...
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp to sufficient read depth with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp to sufficient read depth with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...