Labshake search
Citations for Illumina :
401 - 450 of 2336 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 2) merged triplicates for DC3000 + (Illumina only), 3 ...
-
bioRxiv - Microbiology 2022Quote: ... generating 2 × 300bp paired-end reads (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... and sequenced on 2×150 Miseq (Illumina). Clonal abundances were estimated using a pipeline adapted from 110 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or SMART-Seq™ 2 (Illumina, 20040532), followed by NovaSeq (RIP-seq experiments from Figs ...
-
bioRxiv - Immunology 2023Quote: ... and HiSeq2500 V2 2×150bp (Illumina®) protocols at the “Institut du Cerveau” (ICM ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% PhiX control (Illumina, San Diego, CA, USA) along with positive (DNA sample extracted from the healthy gut ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2019Quote: ... Then perform tagmentation using 2 μl of Tn5 transposase and 12.5 ul 2 × TD buffer (Illumina #FC-121-1031) at 37°C for 1h with 650 rpm shaking ...
-
bioRxiv - Cell Biology 2021Quote: ... with RNA integrity number higher than 7 was used for library preparation using the TruSeq Stranded mRNA Library Preparation Kit (Illumina, San Diego, CA, USA) and sequenced on a NextSEq500 (Illumina) ...
-
bioRxiv - Genomics 2020Quote: ... The pooled library was quality controlled via sequencing at a concentration of 1.7 pM with 35% PhiX on a NextSeq 500 using a mid-output v2 kit (single-end 75 nucleotides, Illumina, San Diego, CA, USA), resulting in an average sequencing depth of 1 million reads ...
-
bioRxiv - Genomics 2020Quote: ... Both re-pooled libraries were then sequenced at a final concentration of 1.7 pM with 25% PhiX on a NextSeq 500 using a high output v2 kit (single-end, 75 nucleotides, Illumina, San Diego, CA, USA), resulting in an average sequencing depth of 9 million reads (range 817 469 – 41.7 million reads).
-
bioRxiv - Microbiology 2020Quote: ... diluted to 1 nM and pooled for further sequencing on the MiniSeq platform (Illumina). For site 11 and 12 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μg RNA was rRNA-depleted using Ribo-Zero Gold rRNA removal kit (Illumina) then cleaned and purified using RNAClean XP Beads (Beckman Coulter) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Ribosomal RNA was depleted from 1 µg of total RNA using Ribozero (Illumina Kit). Sequencing libraries were prepared using the NEXTflex Rapid Directional RNA-Seq Kit ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 sequencing libraries were constructed using TruSeq® Stranded mRNA Library Prep (20020595, Illumina) kit ...
-
bioRxiv - Microbiology 2022Quote: ... 1 µg of RNA sample was rRNA-depleted using the RiboZero kit (Illumina, MRZB12424). Further library preparation of rRNA-depleted samples was performed using TruSeq Stranded mRNA library preparation kit (Illumina ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of each primer tagged with Nextera XT adapter (Illumina, San Diego, USA) and 1ul of DNA template ...
-
bioRxiv - Genomics 2019Quote: ... We reverse transcribed 1 ug of total RNA with the partial P7 adapter (Illumina_4N_21T) and dNTPs with the addition of spiked-in azido-nucleotides (AzVTPs ...
-
bioRxiv - Genomics 2020Quote: ... which included a 1% PhiX spike (PhiX Control v3; Illumina Catalogue FC-110-3001). The data was uploaded to BaseSpace (http://www.basespace.illumina.com ...
-
bioRxiv - Immunology 2019Quote: ... Sequencing was performed using 1×50 single-end reads with a HiSeq3000 instrument (Illumina). Reads were quantified using kallisto and differential expression was assessed using the DESeq2 package in R (Bray et al. ...
-
bioRxiv - Genomics 2021Quote: ... HTO and GDO libraries with two NextSeq 500 1×75 high-output runs (Illumina).
-
bioRxiv - Genomics 2021Quote: ... A NovaSeq S1 1 × 100 Illumina Sequencing System (Illumina Inc., San Diego, CA, USA) was then used to sequence the GBS libraries ...
-
bioRxiv - Genomics 2020Quote: ... using Infinium HumanOmniExpress-24-v1-1-a BeadChip technology (Illumina Inc. San Diego, CA), was performed at the Cancer Genomics Research Laboratory (CGR) ...
-
bioRxiv - Genetics 2021Quote: ... 6 μL of denatured PhiX control (prepared according to Illumina protocol, final concentration 1%) was added to the library ...
-
bioRxiv - Genomics 2021Quote: ... AGENOME-ZPMS-HV2a-1 was generated by realigning the mapped mitochondrial reads from Illumina as well as Nanopore data with the initial assembly.
-
bioRxiv - Neuroscience 2023Quote: ... Paired-end 100bp sequences were generated over 1 lane by NovaSeq6000 using S4FC (Illumina).
-
bioRxiv - Genomics 2023Quote: ... PCRs were performed using index primers (NEBNext multiplex oligos for Illumina, set 1, E7335) and amplified to linear phase ...
-
bioRxiv - Genomics 2023Quote: ... qPCRs were performed using index primers (NEBNext multiplex oligos for Illumina, set 1, E7335) and amplified to linear phase (3-5 PCR cycles).
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were sequenced single-end (1 × 50 bp) on the HiSeq 2500 platform (Illumina) or paired-end (2 × 100 bp ...
-
bioRxiv - Immunology 2024Quote: ... and sequencing was conducted with a 1×100 bp single-end read configuration (Illumina). Each sample was sequenced to a minimum depth of 30 million reads using the NovaSeq6000 system (Illumina) ...
-
bioRxiv - Immunology 2021Quote: ... Genotyping of the VRC cohort and imputation of genetic variants are described in detail elsewhere.55 We interrogated 7,637,921 variants (imputed from 2,783,635 genetic variants with a minor allele frequency ≥ 5%, measured using the Illumina Human Omni 5 BeadChip array, GRCh37) for an association with each of the 166 ToxScan peptides using the penalized quasi-likelihood (PQL ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA expression (RNA-Seq level 3 data) and DNA methylation (Illumina HumanMethylation450 array) data of 33 types of cancers (n=10,528 ...
-
bioRxiv - Genomics 2021Quote: ... Lab 3 sequenced DNA on a NextSeq 550 (Illumina, San Diego, CA, USA), paired-end 2×75 bp ...
-
bioRxiv - Molecular Biology 2020Quote: Create CSV files listing of all 3 sets of barcodes (Illumina, plate, well)
-
bioRxiv - Neuroscience 2023Quote: ... cDNA libraries were prepared using a 3′-Tag-RNA-Seq library kit (Illumina). Sequencing was performed using one lane of a Hi-Seq 4000 platform with pair-end 40 bp reads ...
-
bioRxiv - Genomics 2023Quote: ... and combined with PhiX control (v.3, Illumina Inc, San Diego, CA, USA) at a final concentration of 1% ...
-
bioRxiv - Genomics 2022Quote: ... The library was run across 4 lanes of a NovaSeq (Illumina), multiplexed with other samples.
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA depletion with additional probes recommended by Illumina (Table 4), stranded library preparation (Illumina Ribo-Zero Plus rRNA Depletion w/ Stranded Total RNA) ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were subsequently sequenced (2 x 150 bp or 2 x 200 bp paired-end reads) using a MiSeq (Illumina) equipment.
-
bioRxiv - Synthetic Biology 2022Quote: ... using Qiagen RNeasy Plus kit.200ng of extracted RNA was used to produce SARS-CoV-2 amplicon libraries using the NEBNext SARS-CoV-2 FS Library Prep Kit (Illumina) using the VarSkip Short Express Protocol with 25 minutes fragmentation step and 8 cycles of PCR enrichment ...
-
bioRxiv - Immunology 2020Quote: ... using NextSeq 500/550 v2.5 sequencing reagent kit (read length: 2 × 75 bp) or NovaSeq S1 sequencing reagent kit (read length: 2 × 100 bp) (Illumina) respectively ...
-
bioRxiv - Immunology 2020Quote: ... Sequencing was performed in a high-throughput MiSeq machine using either a v2 Nano reagent kit 2×250bp or a v3 reagent kit 2×300bp (Illumina) at the Genomic Research Unit (GRU ...