Labshake search
Citations for Illumina :
301 - 350 of 1278 citations for 7 CARBOXY 2 MERCAPTOBENZOTHIAZOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... using 2×100bp paired-end reads with an S4 300 cycle kit (Illumina, 20012866). Row A thymus pools were normalized to 2 nM and sequenced separately on the NextSeq 500 Sequencing System (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing was performed using 2×100 bp paired-end mode on HiSeq 4000 (Illumina) in Genomed SA (Warsaw ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were sequenced for 101 cycles (2 × 101bp (PE)) using the NovaSeq 6000 (Illumina) at the Ocular Genomic Institute ...
-
bioRxiv - Developmental Biology 2022Quote: ... using 2×100bp paired-end reads with an S4 300 cycle kit (Illumina, 20012866).
-
bioRxiv - Microbiology 2022Quote: ... library prep and 16S rRNA gene (V4 region) sequencing (Illumina NovaSeq 2 x 250) were conducted separately by Novogene.
-
bioRxiv - Cancer Biology 2022Quote: ... and sequenced in paired-end mode (2×75 bp) with NextSeq 500 (Illumina, CA).
-
bioRxiv - Cancer Biology 2022Quote: ... and sequenced in paired-end mode (2×75 bp) with NextSeq 500 (Illumina, CA).
-
bioRxiv - Genetics 2022Quote: DMDSC genotyping was conducted for approximately 5,801 patients with type 2 diabetes by Illumina using the global screening arrays version (GSA v1.0) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Paired end 2 × 75 bp sequencing was performed on the NextSeq 500 platform (Illumina).
-
bioRxiv - Developmental Biology 2019Quote: ... 2 × 36 base paired-end sequencing was performed with NextSeq500 (Illumina K.K., Tokyo, Japan) by Tsukuba i-Laboratory LLP (Tsukuba ...
-
bioRxiv - Genomics 2019Quote: ... with default settings from Illumina HiSeq 50x (downsampled to two flow cells) 2×150 bp data and from Illumina HiSeq 45x 2×250 bp data for the AJ trio ...
-
bioRxiv - Developmental Biology 2020Quote: ... Amplified cDNA was further processed according to TruSeq Sample Preparation v.2 Guide (Illumina) and paired end-sequenced (2×75 bp ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 2 × 250 bp paired-end sequencing was carried out on an Illumina MiSeq (Illumina) according to the manufacturer’s recommendations at a mean coverage of 300x.
-
bioRxiv - Genomics 2021Quote: ... Paired end 2×151 bp reads were produced using the HiSeq 4000 platform (Illumina). An average of 149 million read pairs were obtained per Seraseq sample (range of 86M to 227M read pairs).
-
bioRxiv - Genomics 2021Quote: ... 2 μg of DNA-free total RNA was ribodepleted using Ribo-Zero Gold (Illumina) according to the manufacturer protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... Paired-end sequencing (2 × 75 bp reads) was performed with NextSeq 500 (Illumina, USA). Reads were aligned to the zebrafish genome assembly GRCz10 using STAR v2.7.7a [61] and samtools v1.11 [62] ...
-
bioRxiv - Genomics 2021Quote: ... Paired end libraries were sequenced using 2 × 300 bp 3rd generation reagent kits (Illumina). Short read data was assembled using the de novo assembly algorithm ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA-sequencing libraries were prepared using the TruSeq RNA Sample Preparation 2 Kit (Illumina). The library quality was checked using an Agilent 2100 Bioanalyzer and concentration was measured by a Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The libraries were sequenced in 2 × 150 nt manner on HiSeq Xten platform (Illumina).
-
bioRxiv - Evolutionary Biology 2021Quote: ... The libraries were sequenced in 2 × 150 nt manner on HiSeq Xten platform (Illumina).
-
bioRxiv - Evolutionary Biology 2021Quote: ... The libraries were sequenced in 2 × 150 nt manner on HiSeq Xten platform (Illumina).
-
bioRxiv - Cancer Biology 2020Quote: ... and 2×50 paired-end sequencing performed on NovaSeq S1 6000 flow cell (Illumina) flow to yield 100M reads per sample.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Samples were paired-end sequenced (2×300 bp) on a MiSeq platform (Illumina, USA) using the MiSeq Reagent kit v3 (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... Demultiplexing and adapter clipping was done using the bcl2fastq(2) conversion software (Illumina, USA).
-
bioRxiv - Evolutionary Biology 2021Quote: ... sample 2 was treated with 20 U RNase R (Epicentre/Illumina, Cat. No. RNR07250) for 1 h at 37°C to degrade linear RNAs ...
-
bioRxiv - Biochemistry 2022Quote: ... or NextSeq with 2 × 151 paired-end reads and v2 or v2.5 chemistry (Illumina), and aligned to the hg38 genomic assembly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing (2 x 100 bp) was carried out with HiSeq 4000 (Illumina), pooling two patients’ samples on one lane ...
-
bioRxiv - Genomics 2022Quote: ... scherzeri were sequenced with 2×150 bp chemistry on the Illumina MiSeq platform (Illumina), respectively ...
-
bioRxiv - Immunology 2022Quote: ... barcoding and sequencing using HiSeq configured for 2×150 bp paired-end reads (Illumina). An average of 28.9 × 106 paired reads was generated per sample with a mean quality score of 35.81 ...
-
bioRxiv - Plant Biology 2022Quote: ... Paired-end reads (2 × 150 bp) were generation on the HiSeq 3000 platform (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... whole SARS-CoV-2 genome cDNA libraries were generated using a MiniSeq system (Illumina) with a MiniSeq mid-output kit ...
-
bioRxiv - Immunology 2022Quote: Individually indexed libraries were sequenced using the MiSeq V3 2 × 300 cycle system (Illumina). The R1 and R2 reads were processed using the IgDiscover (TCR version) ...
-
bioRxiv - Physiology 2022Quote: ... Libraries were pooled and sequenced paired-ended for 2×75 cycles (Nextseq500 sequencer, Illumina). 30-40 million fragments were generated per sample and quality controls were performed ...
-
bioRxiv - Immunology 2023Quote: ... and paired end-sequenced on the NovaSeq 6000 (Illumina, read length 2 x 101bp). Adaptor sequences and polyT tails were trimmed from unprocessed reads with fqtrim (v 0.9.7 ...
-
bioRxiv - Pathology 2023Quote: ... Final pool was sequenced using the 2×151 bp P1 reagent (20050264, Illumina, USA) and NextSeq2000 sequencer ...
-
bioRxiv - Microbiology 2023Quote: ... The libraries were sequenced (2 × 150 base pairs (bp)) on a MiniSeq System (Illumina). Sequencing reads were aligned with the reference sequences and SHAPE-MaP reactivity profiles for each position was calculated using ‘Shapemapper-2.15’37 with default parameter ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced using HiSeq 2000 sequencing with 2 × 150 bp paired-end chemistry (Illumina). On average ...
-
bioRxiv - Microbiology 2023Quote: ... (California, USA) for library prep and 2×150bp sequencing on a NovaSeq6000 (Illumina, USA). The run resulted in 21Gb of data with 140,278,770 raw reads ...
-
bioRxiv - Microbiology 2023Quote: ... 2 × 1 μl (concentration of 10pmol/μl) MiSeq Nextera XT adapters (dual indexed, Illumina), and 6.5 μl of mQ water (Ultrapure) ...
-
bioRxiv - Cancer Biology 2023Quote: ... libraries were sequenced 2 x 150 paired end using a NovaSeq 6000 instrument (Illumina) to get 30x coverage on the genome ...
-
bioRxiv - Microbiology 2023Quote: ... Transposon mutant 19_H4 was sent for whole genome sequencing (Illumina; 2 X 151 bp) to identify the insertion site of the transposon.
-
bioRxiv - Bioengineering 2023Quote: ... Libraries were then sequenced on NextSeq 500 Mid Output with 2×150 bp (Illumina). The Cell Ranger VDJ pipeline was used for sample de-multiplexing and barcode processing.
-
bioRxiv - Plant Biology 2023Quote: ... Paired-end reads (2 x 150 bp) were on a HiSeq 3000 instrument (Illumina). Sequencing reads were first quality trimmed and filtered with Trimmomatic (version 0.36 ...
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... Libraries were subsequently sequenced on a NovaSeq S2 Flowcell (paired end 2×56bp) (Illumina). All samples in this study were prepared and sequenced at the same time ...
-
bioRxiv - Neuroscience 2024Quote: ... using 2 NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Two Nextseq runs were performed to compile enough reads (19-32 million pass-filter reads).
-
bioRxiv - Microbiology 2023Quote: ... and sequenced with 2×150 bp paired-end reads on a NovaSeq platform (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μl of each P5 and P7 primer (Nextera Index Kit, Illumina, CA, USA), 2 μl of initial PCR product ...
-
bioRxiv - Microbiology 2024Quote: ... using the Illumina MiSeq platform with a read length of 2 × 150 bp (Illumina). A subset of 100,000 reads was sampled for each phage ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were pooled and sequenced in (2 x 100bp) on the NovaSeq-6000 (Illumina). Gene and ERV expression was quantified as described (11,31 ...