Labshake search
Citations for Illumina :
1 - 50 of 1913 citations for 7 Bromo 6 chloro 3 3 3 hydroxy 2 piperidyl 2 oxopropyl quinazolin 4 3H one monohydrobromide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Cancer Biology 2019Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Plant Biology 2022Quote: ... We prepare 12 cDNA libraries (3 individuals □ 2 sampling times (dawn and dusk) □ 2 localities) using the TruSeq RNA-seq library prep kit from Illumina (Illumina, Inc., CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Cancer Biology 2019Quote: ... The samples were processed using the 10x Genomics Chromium 3’ Gene Expression Solution (version 2) based on manufacturer instructions and sequenced using a NextSeq 500 sequencer (Illumina).
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were constructed with version 2 (stage 16a) or version 3 (stage15 a/b) chemistry and sequenced on a single HiSeqX (Illumina) lane to generate 400-450 million paired-end 150 bp reads (Supplementary Table 4).
-
bioRxiv - Microbiology 2020Quote: ... The obtained partitions were further processed using the Chromium Single Cell 3’ Reagent Kit (version 2, 10x Genomics) to generate Nextera XT sequencing libraries that were sequenced on a HiSeq3000 (Illumina), using a single flow cell lane for each library.
-
bioRxiv - Microbiology 2023Quote: ... as well as 6 PCR negative control and 3 extraction negatives on a NovaSeq 6000 (Illumina), with 2 Gb requested per sample.
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Immunology 2019Quote: Single-cell RNA-sequencing libraries were generated using the 10x Genomics Single Cell 3’ Solution (version 2) kit and sequenced to an average depth of > 200k reads/cell (Illumina HiSeq 4000). Data analysis was performed using Python3 pipelines (https://github.com/sansomlab/tenx ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
bioRxiv - Genomics 2019Quote: ... to generate ~3 GB data (Illumina, Inc, USA). The total yield of the Number of Paired end was 26,263,128 with the maximum data of 3.78 GB ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Genomics 2023Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Microbiology 2021Quote: ... Goe13 and lysogens and sequenced with the MiSeq system and reagent kit V.3 (2 x 300 bp) (Illumina, San Diego, CA, USA) and the NovaSeq system (2x 150bp ...
-
bioRxiv - Molecular Biology 2019Quote: ... Biomark Access Array system followed by sequencing with 2×225 base pair reads on a MiSeq instrument using version 3 chemistry (Illumina, San Diego, CA). FASTQ files were processed through a custom bioinformatics pipeline (ScanIndel ...
-
bioRxiv - Molecular Biology 2023Quote: ... and each sample was sequenced in 3 different lanes (3 technical replicates per sample) on an Illumina HiSeq platform (Illumina, USA).