Labshake search
Citations for Illumina :
601 - 650 of 1852 citations for 7 Benzyloxy 3 4 dihydro 1H naphthalen 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The full-length cDNA were synthesized using the Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 and sequenced by Illumina HiSeq X Ten platform by Gene Denovo Biotechnology Co ...
-
bioRxiv - Physiology 2022Quote: ... cDNAs were prepared using the single cell 3’ Protocol as per manufacturer’s instructions and sequenced on a NovaSeq 6000 (Illumina) with 26 bases for read1 and 98×8 bases for read2.
-
bioRxiv - Genomics 2019Quote: ... Genotyping was carried out using the Infinium II HumanHap 550K Genotyping BeadChip version 3 (Illumina, San Diego, California USA). Collection and purification of DNA have been described previously (Kayser et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng RNA was prepared with a commercially available kit according to the manufacturer’s instruction (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina ...
-
bioRxiv - Immunology 2020Quote: ... We diluted the final library to 3 nM concentration and used a HiSeq PE150 sequencer (Illumina, San Diego, CA) to perform the sequencing.
-
bioRxiv - Evolutionary Biology 2021Quote: ... DNA sequencing was performed on an Illumina MiSeq at RBGK with version 3 chemistry (Illumina, San Diego, CA, USA) and ran for 600 cycles to generate 2 × 300 bp paired-end reads ...
-
bioRxiv - Pathology 2021Quote: ... Single cell transcriptome libraries of liver cells were prepared with Chromium Single Cell 3’ NextGEM Reagent Kit v3.1 (10X Genomics) to performed sequencing on NextSeq 550 (Illumina) and demultiplexing pipeline with CellRanger v5.0.0 (10x Genomics) ...
-
bioRxiv - Microbiology 2022Quote: ... Short-read sequencing of strain 3-1B was conducted on the Illumina MiSeq platform (Illumina, San Diego, CA, USA) using the NEBNext Ultra II FS DNA library prep kit (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... The library was spiked with 10% of 12.5 pM PhiX and sequenced using 150 cycles of MiSeq version 3 chemistry (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were prepared according to the manufacturer’s protocol using 10X Single-Cell 3’ v3.1 chemistry (10X Genomics, PN-1000128) and sequenced on the NovaSeq platform (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... Single-cell libraries were generated using 10X Genomics Chromium Single-cell 3’ Library RNA-Seq Assays protocols targeting 8,000 cells from each fraction were sequenced on the NovaSeq sequencer (Illumina). The scRNA-seq data were analyzed with the Partek Flow software (Partek Inc) ...
-
bioRxiv - Cancer Biology 2023Quote: ... was constructed using the QuantSeq 3’ mRNA-seq FWD kit (Lexogen) and the UMI Second Strand Synthesis Module (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... The snRNA-seq library were constructed with 10x Genomic protocol (Chromium Single Cell 3’ Reagent Kits v3.1User Guide) and sequenced by Illumina NovaSeq.
-
bioRxiv - Immunology 2023Quote: ... using the Chromium Single Cell Gene Expression Solution 3’ v2 (10x Genomics) and sequenced by the DNA Sequencing Facility (RRID: SCR_017759) using NovaSeq6000 (Illumina) with read lengths of 29-bp + 90-bp (Read1 + Read2) ...
-
bioRxiv - Microbiology 2023Quote: Metagenomic shotgun sequencing was performed at the Norwegian Sequencing Centre on two lanes of the HiSeq 3/4000 (Illumina) generating 150 bp paired-end reads in both lanes ...
-
THE OLFACTORY RECEPTOR Olfr78 REGULATES DIFFERENTIATION OF ENTEROCHROMAFFIN CELLS IN THE MOUSE COLONbioRxiv - Cell Biology 2023Quote: ... before processing through the Chromium Next GEM Single Cell 3’ Reagent Kits V3.1 (10X Genomics) and sequenced on a Novaseq 6000 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... Gel-in-beads and libraries were generated using Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 (10x Genomics) and sequenced using NovaSeq (Illumina). Cell Ranger 7.0.1 ...
-
bioRxiv - Immunology 2024Quote: ... Gene expression and surface protein libraries were generated using the Chromium Next GEM Single Cell 3 ’Reagent Kits v3.1 and sequenced by Illumina MiSeq or NextSeq2000 ...
-
bioRxiv - Genomics 2020Quote: ... De-multiplexing of RNA-Seq reads was conducted using bcl2fastq v.2 (Illumina). Both DNA-Seq and RNA-Seq reads were submitted to FastQC 51 for quality validation.
-
bioRxiv - Molecular Biology 2021Quote: ... 2 × 36 base paired-end sequencing was performed with a NextSeq500 sequencer (Illumina) by Tsukuba i-Laboratory LLP (Tsukuba ...
-
FOXO dictate initiation of B cell development and myeloid restriction in common lymphoid progenitorsbioRxiv - Immunology 2022Quote: ... Libraries were sequenced paired-end (2×50 cycles) on the Illumina platform (Illumina). Reads were mapped using STAR (v 2.5.2b ...
-
FOXO dictate initiation of B cell development and myeloid restriction in common lymphoid progenitorsbioRxiv - Immunology 2022Quote: ... Libraries were sequenced paired-end (2×50 cycles) on the Illumina platform (Illumina). To obtain differential ATACseq peaks ...
-
bioRxiv - Immunology 2021Quote: ... Sequencing had been performed by a 300*2 paired-end kit by Illumina MiSeq ...
-
bioRxiv - Bioengineering 2019Quote: ... and the sequencing was run with a 2×250 bp MiSeq run (Illumina).
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were sequenced (paired-end, 2 × 75 cycles) on NextSeq platform (Illumina Inc.) Fastq underwent to Quality Control using FastQC tool (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) ...
-
bioRxiv - Genetics 2021Quote: ... and subjected to 2 × 50-bp paired-end sequencing on Hiseq XTen (Illumina).
-
bioRxiv - Genomics 2021Quote: ... Each batch was sequenced separately on 1-flowcell (2 lanes) HiSeq 2500 (Illumina) Rapid Mode platform with a single-end (1×50 bp ...
-
bioRxiv - Neuroscience 2021Quote: ... The libraries were sequenced paired ended (2×75bp) on the NextSeq500 instrument (Illumina) to an average of at least 33 million reads ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were sequenced 2 * 50+8+16 bp on a HiSeq2500 sequencer (Illumina). RNA-seq data were processed according to Doyle et al ...
-
bioRxiv - Microbiology 2020Quote: ... Read 1 and 2 adapter recognition sequences were provided for adapter removal (Illumina TruSeq Adapter Read 1 ...
-
bioRxiv - Microbiology 2021Quote: ... An Illumina MiSeq Platform (2×300 cycles; Illumina Inc., San Diego, CA, USA) was used for a paired-end sequencing run ...
-
bioRxiv - Systems Biology 2020Quote: ... a 2 x 300 bp paired end library (Illumina Nextera XT DNA kit) was sequenced on a MiSeq ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μg of RNA were treated with “TruSeq RNA sample preparation kit” (Illumina) combined with a specific strand labeling using dUTPs [36] ...
-
bioRxiv - Molecular Biology 2020Quote: ... Paired-end (150 base pairs × 2) sequencing with the NovaSeq 6000 platform (Illumina) was outsourced to Takara Bio ...
-
bioRxiv - Genomics 2020Quote: ... and 2.5μL (20μM) each of 2 indexed primers (Illumina TruSeq Combinatorial Dual (CD) index adapters ...
-
bioRxiv - Plant Biology 2022Quote: ... we obtained 26–30 × pair-end sequencing reads (150 bp × 2) from Illumina HiSeq 2500 (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Pair-ended 2×75 bp sequencing was performed on the NextSeq 500 (Illumina) at Core Unit Systems Medicine ...
-
bioRxiv - Cell Biology 2022Quote: ... WGS paired-end (PE) reads with 2×150bp configuration were obtained from Illumina HiSeq platform and processed using SAMtools (v1.2 ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing was carried out on a Novaseq6000 S2 2×50bp flow cell (Illumina) utilizing the Chromium single-cell 5′ gene expression library preparation (10X Genomics) ...
-
bioRxiv - Genomics 2022Quote: ... SW-8046-2) from libraries prepared using the Nextera XT DNA kit (Illumina, Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... paired-end (2 × 150 bp) sequencing with the Hiseq 4000 platform (Illumina, USA). The resulting FASTQ files were then aligned against the reference genome (Ankara C9 genome) ...
-
bioRxiv - Microbiology 2021Quote: ... and paired-end sequencing (2 x 150 bp) was performed using MiniSeq (Illumina). Illumina paired-end reads were mapped onto the on-site assembly sequences ...
-
bioRxiv - Cancer Biology 2019Quote: ... Paired-end 2×50 bp sequencing was performed using a HiSeq2500 system (Illumina). Sequencing data are available through the NCBI Gene Expression Omnibus (GEO ...
-
bioRxiv - Genomics 2019Quote: ... Paired-end sequencing (2 × 50 nt) was performed on a HiSeq2500 system (Illumina).
-
bioRxiv - Genomics 2019Quote: ... paired-end (2×150bp) sequencing was performed on a NextSeq 550 system (Illumina) with 20 samples on one run in High Output mode ...
-
bioRxiv - Microbiology 2020Quote: ... Paired-end sequencing (2×250 bases) was performed on a HiSeq 2500 (Illumina) using the HiSeq Rapid SBS Kit v2 (500 cycle ...
-
bioRxiv - Physiology 2020Quote: ... Paired-end (2 × 75 bp) sequencing was performed on the HiSeq4000 system (Illumina). Sequencing data were aligned to the human reference genome using the Burrows-Wheeler Aligner (Li & Durbin ...
-
bioRxiv - Cell Biology 2021Quote: ... LT-PTC and pUC using TruSeq mRNA sample prep kit v.2 (Illumina). Sequence alignment and RNA-Seq analysis ...