Labshake search
Citations for Illumina :
351 - 400 of 1278 citations for 7 BUTYL 2 OXEPANONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA samples were further processes according to the TruSeq Sample Preparation v.2 Guide (Illumina) and paired end-sequenced on the HiSeq 2500 (Illumina).
-
bioRxiv - Cell Biology 2020Quote: ... Small RNA libraries were diluted to 2 nM and run on a miSeq System (Illumina) for NGS using the V2 kit (Illumina) ...
-
bioRxiv - Genetics 2021Quote: ... Libraries were then sequenced with 2×150bp paired-end reads on an Hiseq3000 instrument (Illumina).
-
bioRxiv - Genetics 2021Quote: ... Libraries were prepared with a TruSeq RNA Library Prep Kit version 2 (Illumina RS-122) and sequenced on an Illumina HiSeq4000 in paired-end mode (PE150).
-
bioRxiv - Evolutionary Biology 2021Quote: ... with 300 cycle mid-output (2×150 bp) NextSeq Reagent kits v2 (Illumina Corporation, 20024905). FASTQ files of raw sequencing data were deposited in NCBI database with the Sequence Read Archive (SRA ...
-
bioRxiv - Developmental Biology 2021Quote: ... followed by paired-end sequencing (2 x 75 bp) performed with Nextseq 500 (Illumina, USA). Libraries were sequenced in triplicate ...
-
bioRxiv - Genomics 2020Quote: ... The samples were then sequenced (2×101 cycles, paried end reads) on the HiSeq2500 (Illumina) using the TruSeq SBS Kit v3-HS 200 cycles Kit (Illumina) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2×150bp paired-end sequencing (PE150) was performed on an Illumina Novaseq™ 6000 (Illumina) following the vendor’s recommended protocol.
-
bioRxiv - Genomics 2020Quote: ... Paired end libraries (2×150 bp) were sequenced on an Illumina HiSeq4000 instrument (Illumina Inc.).
-
bioRxiv - Genomics 2020Quote: ... Paired-reads (2×100 bp) were sequenced on the NovaSeq 6000 S2 flowcell (Illumina, Inc.). DNA and RNA library preparation and sequencing were performed at the SNP&SEQ Technology Platform in Uppsala ...
-
bioRxiv - Cell Biology 2019Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample.
-
bioRxiv - Physiology 2020Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample ...
-
bioRxiv - Microbiology 2020Quote: ... and sequenced as 2 × 150 base pair reads on the Illumina NextSeq 550 instrument (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... and sequenced with 2×250 bp cycles of v2 Miseq chemistry (Illumina, San Diego, CA). Replicate reactions from each sample were pooled and gel purified using the Blue Pippin Prep system (Sage Science ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and small-scale sequencing (2 x146bp) on an iSeq platform (Illumina, San Diego, CA, US). Subsequent equimolar pooling of individual libraries from each plate was performed prior to performing large-scale paired-end sequencing (2 × 146 bp ...
-
bioRxiv - Microbiology 2021Quote: ... and sequenced as 2 × 150 base pair reads on the Illumina NextSeq 550 instrument (Illumina).
-
bioRxiv - Cancer Biology 2020Quote: ... and paired-ended [2×150 bp] sequencing was performed on NovaSeq 6000 sequencing system (Illumina). Once the sequencing run was completed ...
-
bioRxiv - Microbiology 2021Quote: ... 100x coverage using a high-output paired end 2 x 150 sequencing regent kit (Illumina).
-
bioRxiv - Synthetic Biology 2022Quote: ... read length 2 × 175 bp using the MiSeq platform (Illumina Inc., San Diego, CA, USA). The library preparation and sequencing were performed in the Institute of Genomics Core Facility ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 x 150 cycles (NextSeq 500/550 Mid Output v2 kit, Illumina, San Diego, CA).
-
bioRxiv - Developmental Biology 2022Quote: ... 2 sequencing libraries were constructed using TruSeq® Stranded Total RNA Library Prep (20020597, Illumina) kit at the National Cancer Institute’s Center for Cancer Research sequencing core facility ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and sequenced with 2 × 250 base paired-end reads on the Illumina MiSeq platform (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Each library was then paired end sequenced (2×75bp) on a NextSeq 500 instrument (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... Sample libraries of sufficient quality were sequenced (Illumina MiSeq; paired end 2 × 75bp read length) with a sequencing depth targeted at 7-10M total paired end reads/sample at the Center for Genome Innovation at the University of Connecticut.
-
bioRxiv - Genomics 2020Quote: ... and then subjected to Next Generation Sequencing in NextSeq 550 equipment (2×150bp) (Illumina, USA). The reads were deposited in the European Nucleotide Archive (ENA ...
-
bioRxiv - Systems Biology 2020Quote: ... Paired-end sequencing (2×125-bp) was carried out on a HiSeq 2500 instrument (Illumina) at the Kinghorn Center for Clinical Genomics ...
-
bioRxiv - Molecular Biology 2019Quote: ... Libraries were pooled and pair-end sequenced (2×75 bp) on the MiSeq platform (Illumina). Two biological replicates of each immuprecipitation were analysed ...
-
bioRxiv - Molecular Biology 2019Quote: DNA libraries were sequenced on a MiSeq using 2×75 paired-end chemistry (v3, Illumina) Sequenced MiSeq chips were stored at 4°C in storage buffer (10 mM Tris-Cl ...
-
bioRxiv - Microbiology 2020Quote: ... DNA sequencing was performed using a MiSeq v2 500 cycle kit (2×250bp reads; Illumina). Raw reads were trimmed using fastq-mcf and assembled using SPADES v3.9.1 [25] ...
-
bioRxiv - Microbiology 2021Quote: ... High-throughput sequencing was performed with a MiSeq Illumina sequencer (2 × 300 bp, Illumina Inc.) by the Biomics Pole (Institut Pasteur) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were 6-plexed and sequenced with 2×100bp reads on a HiSeq-4000 (Illumina). The data were mapped using BWA ...
-
bioRxiv - Immunology 2021Quote: The 150×2 paired-end sequencing was conducted on a Novaseq sequencer (Illumina, CA, USA) producing 612,180,910 raw paired reads on average.
-
bioRxiv - Cancer Biology 2020Quote: ... 1–2 mg of total RNA was used for Ribo-Zero rRNA Removal kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were sequenced as paired end 2×151 read multiplex runs on MiSeq platform (Illumina). Sequenced reads have been uploaded to the NCBI SRA database under BioProject ID PRJNA762079.
-
bioRxiv - Genomics 2021Quote: ... the 18 individual libraries were pooled using equimolar amounts and sequenced by Illumina NovaSeq 2×150 cycles run for a total of 0.5 lane (Illumina Inc., CA, U.S.)
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were constructed from 2 μL of DNA using the Nextera XT Kit (Illumina) and cleaned with 0.6x volumes of Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Physiology 2022Quote: ... Samples were sequenced on the HiSeq 2500 (Figure 2) or NovaSeq 6000 (Figure 6; Illumina) using a 2×100 kit to a read depth >45 million reads/sample ...
-
bioRxiv - Genomics 2022Quote: ... We downsampled the existing Illumina (2×150 bp, generated with Illumina HiSeq 2500 Rapid SBS) alignment file of 300× to ~100× ...
-
bioRxiv - Cancer Biology 2022Quote: Paired-end sequencing (2 x 150 bp) was performed with HiSeq X-Ten instruments (Illumina). Two lanes ...
-
bioRxiv - Microbiology 2022Quote: ... Whole genome was paired-end sequenced (2 × 150 bp) in an Illumina NovaSeq6000 platform (Illumina) at Centro Nacional de Análisis Genómico (CNAG-CRG ...
-
bioRxiv - Plant Biology 2023Quote: ... before being prepared for loading using a NovaSeq XP 2 lane kit v1.5 (20043130, Illumina). This was sequenced with 150 paired-end reads on an Illumina NovaSeq 6000 with NVCS 1.7.5 and RTA v3.4.4 on one lane of a NovaSeq S4 v1.5 flow cell with accompanying reagent cartridges (20028312 ...
-
bioRxiv - Immunology 2023Quote: ... and sequenced using the MiSeq 2 × 300 base pair (bp) paired-end sequencing platform (Illumina). Integrated indexed flow cytometry and sequence data integration as well as Ig gene annotation was performed using sciReptor version 1.0-6-g034c8ae (Busse et al. ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5 μl of Nextera XT index primers 1 and 2 (Nextera XT Index kit, Illumina) and 2.5 μl of templated DNA ...
-
bioRxiv - Molecular Biology 2022Quote: The whole genome sequencing of SARS-CoV-2 was performed on MiSeq System (Illumina technology), that is installed at R’VRDL ...
-
bioRxiv - Microbiology 2022Quote: ... and then sequenced at 2×250bp on an Illumina MiSeq (Illumina, San Diego, CA, USA) at the Genomics Core Facility ...
-
bioRxiv - Biophysics 2023Quote: ... using iSeq 100 i1 reagent v2 kit (300 cycle) 2 x 150 read length (Illumina). The total number of reads were 150,000-400,000 per sample ...
-
bioRxiv - Cancer Biology 2023Quote: DNA isolated from the immunoprecipitated samples underwent paired-end sequencing (2×150bp on an Illumina NovaSeq-S4-PE 150 Cycle instrument ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we sequenced paired-end reads with a 2×151+18+8bp length on NovaSeq6000 (Illumina) to reach at ∼30X coverage per sample ...
-
bioRxiv - Microbiology 2023Quote: ... paired read approach to sequence amplicons using the MiSeq 2 × 250 platform (Illumina, Inc. USA) at the Georgia Genomics and Bioinformatic Core (UGA ...