Labshake search
Citations for Illumina :
201 - 250 of 711 citations for 7 ACETOXY 6 METHOXY 3 4 DIHYDROQUINAZODIN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... and sequenced on one high output flowcell of an Illumina NextSeq 500 (Illumina) with paired-end 40 bp reads.
-
bioRxiv - Genomics 2021Quote: ... and paired-end sequenced on one lane of a HiSeq 2500 platform (Illumina).
-
bioRxiv - Genetics 2020Quote: ... Barcoded libraries were sequenced using HiSeq4000 (Illumina, one lane per 10x chip position) with 50bp or 75bp paired end reads to an average depth of 40,000-60,000 reads per cell.
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Microbiology 2019Quote: ... mixed with the PhiX control library v3 (diluted to 7 pM; Illumina, San Diego, USA), and loaded on an Illumina MiSeq cartridge ...
-
bioRxiv - Cell Biology 2019Quote: ... The libraries were sequenced in 1 x 100 +7 manner on HiSeq 2000 platform (Illumina).
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct, n=6; Illumina TruSeq RNA Exome, n=5) was sequenced on one lane on the Illumina HiSeq 3000 platform in the Technology Center for Genomics and Bioinformatics at UCLA ...
-
bioRxiv - Genetics 2020Quote: ... and the libraries were sequenced in pools of 6 (Illumina HiSeq2500 high output flow-cell ...
-
bioRxiv - Genomics 2022Quote: ... the ScriptSeq™ Index PCR Primers (Sets 1 to 4) and the FailSafe™ PCR enzyme system (all sourced from Epicentre®/Illumina® Inc., Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... The library was sequenced on one lane of a rapid v2 flow cell (Illumina) in paired end 2*250nt mode ...
-
bioRxiv - Microbiology 2019Quote: We sequenced the pooled libraries in one lane of the HiSeq 4000 (Illumina, www.illumina.com) with 150 PE chemistry.
-
bioRxiv - Immunology 2021Quote: ... One pooled library containing 26 samples were sequenced on a NextSeq 500 sequencer (Illumina) using paired-end 38-base reads ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... rotundus assembly with at least one shared homozygous (based on aligned Illumina sequencing reads) inactivating mutation ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... in a fraction of one sequencing lane of an HiSeq2000 flowcell v3 (Illumina Inc.) according to standard Illumina operation procedures at Centro Nacional de Análisis Genómico (CNAG).
-
bioRxiv - Molecular Biology 2020Quote: ... One μg of total RNA was reverse transcribed with the partial P7 adapter (Illumina_4N_21T) and dNTPs with the addition of spiked-in azido-nucleotides (AzVTPs ...
-
bioRxiv - Genomics 2021Quote: ... All libraries were sequenced in one sequencing run on NextSeq 500 high-output (Illumina) with 85 bp single-end reads ...
-
Robust Cancer Mutation Detection with Deep Learning Models Derived from Tumor-Normal Sequencing DatabioRxiv - Genomics 2019Quote: ... and the last one was constructed by combining 9 NovaSeq sequencing replicates from Illumina to get a replicate pair with ∼390× coverage ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... One library was prepared for each individual using the TruSeq Stranded mRNA protocol (Illumina) and cDNA was sequenced on an Illumina NovaSeq 6000 to generate an average of 87 million 150 bp paired-end reads per library (Table S1) ...
-
bioRxiv - Genomics 2020Quote: ... The resulting libraries were sequenced with one sample per lane using the NextSeq500 (Illumina; high-output mode ...
-
bioRxiv - Immunology 2021Quote: ... The libraries were multiplexed and sequenced using one flow cell on Novaseq 6000 (Illumina) as 50bp paired-end reads ...
-
bioRxiv - Genomics 2021Quote: ... The pooled final library was sequenced on one to four lanes of HiSeq2000 (Illumina) with 68 base (Y ...
-
bioRxiv - Cancer Biology 2023Quote: ... One barcoded library was prepared per plate using TD buffer and TDE1 enzyme (Illumina) for tagmentation and KAPA HiFi HotStart Ready Mix (Roche ...
-
bioRxiv - Genomics 2023Quote: ... cycle one begins with incorporation of the first nucleotide in Incorporation Mix (Illumina MiSeq), followed by incubation with shaking at 60°C for 3 min ...
-
bioRxiv - Plant Biology 2023Quote: ... one microgram of crosslinked enriched chloroplasts was resuspended in 1X Tn5 reaction buffer (Illumina) and assayed according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... and run in one lane on a flow cell of NovaSeq 6000 SP (Illumina).
-
bioRxiv - Genetics 2023Quote: ... and the libraries were subjected to 1 × 7 bp high-throughput sequencing by NextSeq 500 (Illumina).
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 6-digit index primers (Illumina RNA PCR Index Primers RPI1-RPI28) were used instead of 10-digit index primers suggested by the LM-Seq protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Index i7 (6 pb barcode) was read with primer HP8 (Illumina).
-
bioRxiv - Evolutionary Biology 2022Quote: ... Libraries were sequenced on one lane of a HiSeq4000 (PE 150; Illumina San Diego, California).
-
bioRxiv - Genomics 2019Quote: ... four Illumina libraries were prepared and sequenced on a HiSeq2000: one paired-end library (Illumina TruSeq DNA PCR-free LT Sample Prep kit #15036187 ...
-
bioRxiv - Neuroscience 2020Quote: ... mixed in equimolar ratios and sequenced on one flow cell of NovaSeq S Prime (Illumina).
-
bioRxiv - Molecular Biology 2021Quote: ... Sequencing was carried out on one lane of an Illumina 2500 Hiseq instrument (Illumina Inc.) using 125 cycle chemistry in paired-end (PE ...
-
bioRxiv - Biochemistry 2020Quote: ... The sample was submitted to one channel of Illumina flow cell and sequenced by Illumina Genome Analyzer (GAII ...
-
bioRxiv - Genomics 2021Quote: ... Metagenomic sequencing was performed on one SP lane of the NovaSeq 6000 sequencing system (Illumina) at the Roy J ...
-
bioRxiv - Cancer Biology 2022Quote: ... the library from patient one was sequenced with an Illumina HiSeq 4000 (Illumina, Berlin, Germany) at the DKFZ Genomics and Proteomics Core Facility in Heidelberg and all other libraries were sequenced on an Illumina NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... one nanogram of DNA was fragmented and adapter ligated using the Nextera XT kit (Illumina) and unique 8bp dual-index adapters (IDT ...
-
bioRxiv - Developmental Biology 2023Quote: ... the libraries were multiplexed into one pool and sequenced using the Illumina HiSeq2500 instrument (Illumina) at National Institute for Basic Biology in Okazaki ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and the 7 other libraries were single-end sequenced using 50 cycles on a HiSeq2500 sequencer (Illumina) at the IGBMC GenomEast Platform (Illkirch ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Genomic DNA (7 ng) from each sample was first fragmented using a partial Nextera reaction (Illumina, Inc), which also ligates short adapter sequences to the ends of the fragments ...
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp to sufficient read depth with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp to sufficient read depth with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...