Labshake search
Citations for Illumina :
101 - 150 of 2296 citations for 7 8 9 10 TETRAHYDRO 6H AZEPINO 2 1 B QUINAZOLIN 12 YLIDENEAMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... or 10 minutes (H3K27ac) with 1 µl of Tn5 transposase (Illumina 15027865 ...
-
bioRxiv - Cancer Biology 2020Quote: ... with MiSeq Reagent Kit V3 (150 cycle) (Illumina, MS-1-2-3001). The sequencing data was de-multiplexed and trimmed to contain only the sgRNA sequence cassettes ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... (b) after index annealing with the Illumina indexing primer set (Illumina, #20020492), 12 PCR cycles were used for cDNA amplification ...
-
bioRxiv - Plant Biology 2023Quote: ... and together with Illumina TruSeq DNA sgl Index Set A/B (Illumina) to perform adapter ligation ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Nextera XT Index Kit v2 Set B (FC-131-2002, Illumina). 1.5 µl Nextera PCR Master Mix and 0.5 µl of a unique combination of primers were added to each well using the I.DOT and tagmented cDNA was amplified in a C1000 Thermal Cycler (72 °C for 3 min ...
-
bioRxiv - Microbiology 2024Quote: ... with the Nextera XT v2 Index Kit B (Illumina FC-131-2002) and then subsequently sequenced on an Illumina MiSeq instrument using a MiSeq Reagent kit v3 600 cycle (Illumina MS-102-3033 ...
-
bioRxiv - Microbiology 2020Quote: ... then further diluted to 8 pM in HT1 buffer (Illumina) and were sequenced using an Illumina MiSeq V2 500 cycle kit cassette with 16S rRNA library sequencing primers set for 250 base pair ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was diluted 1:15 and subsequently tagmented and amplified for 12 cycles using the Nextera XT DNA Library Preparation Kit (Illumina FC-131). Individual libraries were QC’d by Qubit and Agilent Bioanalyzer ...
-
bioRxiv - Genomics 2019Quote: ... 500bp and 800bp) and long insert mate-pair reads (4-6Kb, 8-10Kb and 1-20Kb) were sequenced using HiSeq 2500 (Illumina Inc., USA) at SciGenom Labs ...
-
bioRxiv - Developmental Biology 2019Quote: ... At least 1.5ug of total RNA (RIN>9) was prepared for stranded RNA sequencing using TruSeq kits (Illumina). Samples were poly(A)-enriched ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples with a RIN value of > 7 were used for library preparation (Illumina TruSeq Stranded Total RNA kit ...
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
bioRxiv - Genomics 2023Quote: ... All libraries were pooled and subjected to paired-end 75 bp sequencing (paired- end 76 nt reads with the first 1 nt of Read 1 and the last 1 nt of Read 2 trimmed) using the NextSeq500 system (Illumina, CA, USA). For each library ...
-
bioRxiv - Genomics 2021Quote: ... Each batch was sequenced separately on 1-flowcell (2 lanes) HiSeq 2500 (Illumina) Rapid Mode platform with a single-end (1×50 bp ...
-
bioRxiv - Microbiology 2020Quote: ... Read 1 and 2 adapter recognition sequences were provided for adapter removal (Illumina TruSeq Adapter Read 1 ...
-
bioRxiv - Microbiology 2023Quote: ... gRNA abundances (read 1) and UMI barcodes (read 2) were quantified by Illumina sequencing and subsequently processed by the analysis described below.
-
bioRxiv - Systems Biology 2019Quote: ... six-base indexes distinguish samples and allow multiplexed sequencing and analysis using 48 unique indexes ((Set A: indexes 1-12 (Illumina, RS-200-0012), Set B ...
-
bioRxiv - Genomics 2020Quote: ... We spiked 12 pM library with 1% PhiX control (PhiX Control v3) and sequenced on an Illumina MiSeq platform (Illumina, San Diego, USA) using a MiSeq Nano Reagent Kit v2 (500 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TruSeq RNA Single Indexes Set A and B (Illumina, # 20020492 and 20020493). Library qualities and sizes were checked with the TapeStation 4200 and then quantified using the KAPA Library Quantification Kit for Illumina platforms (Kapa Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... The B-allele frequency and Log R ratio values were downloaded from Illumina GenomeStudio and processed and plotted using the GWASTools package in R (v3.6.1 ...
-
bioRxiv - Microbiology 2023Quote: ... with 6 nucleotides library indexes (DNA Single Indexes Set A or B, Illumina). To achieve sufficient variability during the first five sequencing cycles ...
-
bioRxiv - Genomics 2022Quote: ... and diluted to 12 pM for sequencing on NovaSeq 6000 (Illumina) according to manufacturer’s guidelines with the exception of a custom sequencing primer (MetSeq Primer ...
-
bioRxiv - Immunology 2019Quote: ... Resultant cRNAs were hybridized onto HumanHT-12 v4 Expression BeadChips (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... the Nextera indices (12 pool-specific indices, Illumina, FC-131-2001) and 10 µM P5-TSO hybrid primer (5’-AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCA ACGCAGAGT*A*C-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: Gene expression data (cDNA microarray profiling, Illumina HT-12 v3 platform) from Molecular Taxonomy of BRCA International Consortium (METABRIC ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RNA integrity > 9) were selected for library preparation using the Illumina Stranded mRNA Prep Ligation protocol (Illumina, USA), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... Consensus LADs (between the Nanopore-DamID undiluted and 1:1/10 dilution and between the two Illumina replicates) were determined using intersectBed.
-
bioRxiv - Molecular Biology 2020Quote: Libraries were mixed in equimolar amounts (10 to 15 libraries per pool) and library pools were sequenced on a HiSeq 2000 (2×75bp) (Illumina) at the CNAG ...
-
bioRxiv - Genomics 2021Quote: ... The multiplexed pool was quantified by qPCR and sequenced (paired-end, 2 x 151 cycles and 10 bp for the index reads) using a NovaSeq 6000 device (Illumina) at 3-fold coverage.
-
bioRxiv - Microbiology 2022Quote: ... The 10-pM final library was sequenced on the Illumina MiSeq sequencing platform (2 × 150bp paired-end reads) (Illumina Inc.).
-
bioRxiv - Genetics 2023Quote: ... 10 ng of amplicon DNA from PCR reaction 1 was combined with 10 µL of Nextera adapter index primers (Illumina Cat#20027213) and 25 µL Kapa HiFi Hotstart ReadyMix ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 1 μl of each Nextera XT Index Kit v2 set B or set C barcoding primer (Illumina, Cat# FC-131-2002 or FC-131-2003). These reactions were then incubated at 95°C for 15 minutes ...
-
bioRxiv - Genomics 2020Quote: ... We spiked in 1% PhiX control (PhiX Control v3) in a 12 pM library and sequenced on an Illumina MiSeq platform (Illumina, San Diego, CA, USA) using a MiSeq Nano Reagent Kit v2 (500 cycles).
-
bioRxiv - Cell Biology 2021Quote: ... using NextSeq 500 (2×75 bp) and HiSeq 4000 (1×50 bp) equipment (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... 2 × 1 μl (concentration of 10pmol/μl) MiSeq Nextera XT adapters (dual indexed, Illumina), and 6.5 μl of mQ water (Ultrapure) ...
-
bioRxiv - Microbiology 2020Quote: ... Read 1 and 2 adapter recognition sequences were provided for adapter removal (Illumina TruSeq Adapter Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCT TG, Illumina TruSeq Adapter Read 2 ...
-
bioRxiv - Neuroscience 2022Quote: ... using single end 75bp for Read 1 and 8bp for index 1 and 8bp for Index 2 with a high output 75bp kit (20024906, Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... Libraries were prepared from 9 biological replicates of each condition using the Truseq Stranded mRNA Library Prep Kit (Illumina #20020594) following manufacturer’s instructions and sequenced using the HiSeq-2500 sequencing platform (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... The pooled library contained three samples at 6 pM with 9% PhiX and was sequenced with a 50-cycle single-end MiSeq reagent kit (Illumina). The sequencing reads were aligned to the reference genome (NC 000913.3 ...
-
bioRxiv - Microbiology 2019Quote: ... RNA libraries were multiplexed and run across 9 lanes (infected tissues) or 3 lanes (uninfected tissues) for paired end sequencing by Illumina HiSeq 2500 at the University of Wisconsin Biotechnology Center ...
-
bioRxiv - Microbiology 2021Quote: ... The 9 genomic DNA pools for sequencing were prepared by mixing equimolar concentrations of DNA from which 9 libraries were prepared with an insert size of 350 bp using a TruSeq PCR-free sample prep kit (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... performed the library preparation for WGS of parental and resistant cells of cell lines #3 and #9 as well as a control tail samples corresponding to line #3 with the TruSeq DNA PCR-free Kit (Illumina) and the 150 bp paired-end sequencing on a HiSeq X (Illumina).
-
bioRxiv - Cell Biology 2019Quote: ... only samples with RIN value more than 9 were proceeded for the library construction using Illumina TruSeq Stranded Total RNA Library Preparation Kit (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples with RNA integrity number (RIN) > 9 were used for sequencing library construction with the TruSeq Stranded mRNA sample preparation protocol (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... sequences (9 Go for cell lines and 15 Go for acinar cells) were generated using a NovaSeq 6000 apparatus (Illumina) by Novogen (Cambridge ...
-
bioRxiv - Microbiology 2023Quote: ... and colonising (clinical non-CAPA) (C402, C404-C407, C409, C410) isolates from the Netherlands (n=9) were sequenced using NextSeq 550 sequencer (Illumina), and 218 UK and Irish isolates and the five IA isolates (C307 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified multiplex libraries were diluted to 9 nM concentration (calculated based on Qubit dsDNA HS Assay Kit) and sequenced on a NovaSeq 6000 instrument (Illumina) from IntegraGen SA ...
-
bioRxiv - Genomics 2023Quote: ... Three RNA extractions passing QC (RIN > 9) were pooled in equimolar concentrations and a single transcriptomic library was constructed using Truseq mRNA kit (Illumina) and sequenced on a Illumina Novaseq 6000 sequencer (200M reads ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were prepared using the TruSeq®Stranded mRNA LT Set B kit (Illumina) and sequenced (2×100bp ...
-
bioRxiv - Microbiology 2022Quote: ... according to the “16S Metagenomic Sequencing Library Preparation” protocol (Illumina, art #15044223 Rev. B). The quantity and quality of the cleaned amplicons were assessed using a Thermo Fisher Scientific Qubit 4.0 fluorometer with the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific ...