Labshake search
Citations for Illumina :
1 - 50 of 163 citations for 7 12 Dimethylbenz a ant racene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 7) DC3000 − A (Illumina only), 8 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries from 7 independent SCL-exo experiments were sequenced on 7 lanes of a HiSeq 1500 (Illumina) by the GEH facility (Rennes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 12 times 8 Nextera (Illumina) based primer combinations were used ...
-
bioRxiv - Genomics 2019Quote: ... Probe sets (ILLUMINA HumanHT 12 V4) were assigned to gene names ...
-
bioRxiv - Genomics 2022Quote: ... and 12% PhiX control library v3 (Illumina) was spiked into the library ...
-
bioRxiv - Microbiology 2020Quote: ... Shotgun metagenomic libraries were then constructed from a subset of these animals (LDC N = 15, DDC N = 7, CZMD N = 7) using the Nextera XT kit (Illumina, San Diego, CA USA) and sequenced on and Illumina HiSeq 3000 using a 150bp PE sequencing kit (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... by 7 cycles PCR (16S Metagenomic Sequencing Library Preparation, Illumina). The amplicon libraries were purified using Agencourtusing the Agencourt AMPure XP system (Beckman) ...
-
bioRxiv - Cancer Biology 2020Quote: ... of 34,363 (HT-12 v3 platform, Illumina_Human_WG-v3) probes representing 24,369 genes ...
-
bioRxiv - Microbiology 2021Quote: ... 12 assemblies were done: 1) baseline (Illumina only), 2 ...
-
bioRxiv - Microbiology 2022Quote: ... a SnakeMake pipeline to assemble sequencing data produced by Illumina (7). The pipeline integrates different quality control tools like FastQC (31 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and gene expression (Illumina HumanHT-12 V4.0 expression beadchip) data from the Oslo cohort were obtained from the Gene Expression Omnibus (GSE68339) ...
-
bioRxiv - Immunology 2020Quote: ... Microarray was performed using the HumanHT-12 beadchip (Illumina, Inc. ...
-
bioRxiv - Developmental Biology 2020Quote: ... 12 million 2×150 bp reads (Illumina Nextseq 500) were sequenced for each library.
-
bioRxiv - Systems Biology 2023Quote: ... we downloaded gene expression data (Illumina HT 12, EGAD00010000434) and miRNA expression data (Agilent ncRNA 60k ...
-
bioRxiv - Cancer Biology 2023Quote: ... and a microarray-based technology (Illumina HT-12 arrays) (30 ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples with a RIN value of > 7 were used for library preparation (Illumina TruSeq Stranded Total RNA kit ...
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
bioRxiv - Genomics 2022Quote: ... and diluted to 12 pM for sequencing on NovaSeq 6000 (Illumina) according to manufacturer’s guidelines with the exception of a custom sequencing primer (MetSeq Primer ...
-
bioRxiv - Immunology 2019Quote: ... Resultant cRNAs were hybridized onto HumanHT-12 v4 Expression BeadChips (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... the Nextera indices (12 pool-specific indices, Illumina, FC-131-2001) and 10 µM P5-TSO hybrid primer (5’-AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCA ACGCAGAGT*A*C-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: Gene expression data (cDNA microarray profiling, Illumina HT-12 v3 platform) from Molecular Taxonomy of BRCA International Consortium (METABRIC ...
-
bioRxiv - Cell Biology 2020Quote: ... and hybridized on Illumina whole-genome HumanHT-12 v 4.0 chip (Illumina). Acquisition and data analysis were performed as previously described14 ...
-
bioRxiv - Genomics 2020Quote: ... Fragments were amplified with 12–18 cycles using adaptor specific primers (Illumina); fragments ranging between 300 and 500⍰bp in size were gel-purified before cluster generation and sequencing ...
-
bioRxiv - Neuroscience 2019Quote: ... and diluted to 12 pM for sequencing on the NovaSeq 6000 (Illumina) according to manufacturer’s guidelines with the exception of a custom sequencing primer (MetSeq Primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... these analyses were performed on a Human HT-12-v4 BeadChip (Illumina) after labeling (Ambion ...
-
bioRxiv - Cancer Biology 2021Quote: ... and mRNA expression was determined with the HT-12 v4 chip (Illumina, San Diego ...
-
bioRxiv - Genetics 2021Quote: ... whereas the Illumina Human HT-12 v4 beadchip (Illumina, San Diego, CA) is a genome-wide array targeting about 31,000 genes (with on average 2 probes per gene ...
-
bioRxiv - Systems Biology 2023Quote: ... and hybridized to HumanHT-12 v4 BeadChip microarrays (Illumina, BD-901-1001) as described previously20 ...
-
bioRxiv - Microbiology 2019Quote: ... mixed with the PhiX control library v3 (diluted to 7 pM; Illumina, San Diego, USA), and loaded on an Illumina MiSeq cartridge ...
-
bioRxiv - Cell Biology 2019Quote: ... The libraries were sequenced in 1 x 100 +7 manner on HiSeq 2000 platform (Illumina).
-
bioRxiv - Genomics 2021Quote: ... The data was measured using the Illumina HT-12 v3 platform (Illumina_Human_WG-v3). This dataset included the mutation status of the TP53 gene ...
-
bioRxiv - Microbiology 2021Quote: ... 12-15 million sequence reads per sample were obtained on a HiSeq4000 (Illumina) with 150 bp read length.
-
bioRxiv - Genomics 2020Quote: ... cRNA samples were then hybridized to HumanHT-12 v3 Expression BeadChips (Illumina, Inc.).
-
bioRxiv - Pathology 2022Quote: ... The constructed 12 cDNA libraries were sequenced on Illumina HiSeqTM 4000 platform (Illumina). Raw data are available in NCBI Short Read Archive database (http://www.ncbi.nlm.nih.gov/sra/ ...
-
bioRxiv - Systems Biology 2023Quote: ... and biotinylated as described 8 using HumanHT-12 v4 Expression BeadChips (Illumina, Inc.). Gene expression data were extracted and log2-transformed using GenomeStudio software (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: Genome integrity was assessed by the Infinium HumanCytoSNP-12 v2.1 BeadChip array (Illumina) using genomic DNA from iPSC lines (UCL Genomics) ...
-
bioRxiv - Genetics 2023Quote: ... and the libraries were subjected to 1 × 7 bp high-throughput sequencing by NextSeq 500 (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: ... using Illumina whole-genome expression array Human HT-12 V4 (Illumina, Saffron Walden, U.K.). Normalization of the quantified signals (background corrected ...
-
bioRxiv - Developmental Biology 2019Quote: The (Illumina, San Diego, CA gene expression arrays (Illumina Human HT-12 Expression BeadChip) and Infinium 450K CpG methylation raw array data analyzed in these studies were published previously and available at Gene Expression Omnibus under accession numbers GSE65211 and GSE65214 ...
-
bioRxiv - Genomics 2019Quote: ... Hybridization of 2000 ng of labelled cDNA to the Illumina HumanHT-12 v3 (Illumina) were processed according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: The sequencing-ready library (12 pM) was loaded onto a flow cell from Illumina MiSeq Reagent Kit v3 (150-cycle format ...
-
bioRxiv - Microbiology 2020Quote: ... This denatured library was diluted to 12 pM loading concentration with HT1 buffer (Illumina). PhiX control (20 pM ...
-
bioRxiv - Genomics 2022Quote: ... Both the HumanCytoSNP-12 BeadChip and the ImmunoChip platforms (Illumina, San Diego, CA, USA) were used to genotype the isolated DNA ...
-
bioRxiv - Genomics 2023Quote: ... and diluted to 12 pM for sequencing on the MiSeq and NovaSeq 6000 (Illumina) according to manufacturer’s guidelines with the exception of a custom sequencing primer (MetSeq Primer ...
-
bioRxiv - Genetics 2023Quote: ... Post-capture PCR was performed for 12 cycles and libraries were sequenced by Illumina HiSeq 2000 (paired-end 100bp).
-
bioRxiv - Evolutionary Biology 2020Quote: ... and the 7 other libraries were single-end sequenced using 50 cycles on a HiSeq2500 sequencer (Illumina) at the IGBMC GenomEast Platform (Illkirch ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Genomic DNA (7 ng) from each sample was first fragmented using a partial Nextera reaction (Illumina, Inc), which also ligates short adapter sequences to the ends of the fragments ...
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp to sufficient read depth with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp to sufficient read depth with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
bioRxiv - Genomics 2019Quote: ... Bead-bound Hi-C DNA was amplified with 7 PCR amplification cycles using PE PCR 1.0 and PE PCR 2.0 primers (Illumina). After PCR amplification ...