Labshake search
Citations for Illumina :
1 - 50 of 2185 citations for 7 Diethylamino 3 nitro 2H 1 benzopyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Genomics 2023Quote: We sequenced one elephant reference genome (Em538) to ~60× (2 lanes of Illumina Hiseq X Ten) coverage and eight additional female genomes (4 Asian and 4 African ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Genetics 2021Quote: ... Libraries were each sequenced on one full 2 × 150 bp PE (paired end) HiSeq 4000 lane (Illumina).
-
bioRxiv - Microbiology 2019Quote: ... and sequenced with paired-ends (2×125bp) on one lane of an Illumina HiSeq3000 platform (Illumina Inc) at the Norwegian Sequencing Center (NSC ...
-
bioRxiv - Microbiology 2020Quote: ... one PCR reaction of 12 cycles was performed (using 2 µL of 3C library, 0.2 µM Illumina primers PE1.0 and PE2.0 and 1 unit of Taq Phusion [Finnzymes]) ...
-
bioRxiv - Microbiology 2021Quote: ... 7) DC3000 − A (Illumina only), 8 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Sequencing was performed on a HiSeq 2000 series for 2 × 100 paired end reads with a 7 nucleotide read for indexes using Cycle Sequencing v3 reagents (Illumina). All regions were covered by >200 reads.
-
bioRxiv - Microbiology 2020Quote: ... One paired end sequencing run (2 x 301) was completed on an Illumina MiSeq instrument (Illumina, San Diego, CA) using v3 chemistry ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Cell Biology 2019Quote: ... The libraries were sequenced in 1 x 100 +7 manner on HiSeq 2000 platform (Illumina).
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added four mate pair libraries (3 kb, 5 kb, 7 kb, 8 kb) prepared using a Nextera Mate Pair Library Prep kit (Illumina, San Diego, CA, USA). Each library was sequenced on an Illumina HiSeq 2500 sequencer by Novogene (Sacramento ...
-
bioRxiv - Genetics 2019Quote: ... The coding and splice-site regions of genes susceptible to hereditary arrhythmia and cardiomyopathies(10) were sequenced for probands II:3 and III-7 using Illumina HiSeq2500 Analyzer (Illumina, San Diego, CA, USA)(11) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... All three reactions were pooled in equal-molar ratios and sequenced (paired end 300 bp) on one lane of Illumina MiSeq version 3 chemistry (Illumina, San Diego, California). The final reaction comprising 21 libraries with DNA concentrations 11.4 – 20.0 ng/μl was performed and sequenced as above.
-
bioRxiv - Plant Biology 2021Quote: ... Eighteen libraries differentially indexed using the FastGene Adaptor kit (Nippon Genetics) were multiplexed in one lane and sequenced (2 × 150-bp paired-end reads) on a HiSeq X (Illumina) by GENEWIZ.
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries from 7 independent SCL-exo experiments were sequenced on 7 lanes of a HiSeq 1500 (Illumina) by the GEH facility (Rennes ...
-
bioRxiv - Genetics 2023Quote: ... and the libraries were subjected to 1 × 7 bp high-throughput sequencing by NextSeq 500 (Illumina).
-
bioRxiv - Genetics 2019Quote: ... An average of 39.7 million 2 x 75 bp paired- end reads were generated for each sample on an Illumina NextSeq 500 (Illumina, Carlsbad, CA). FastQC was used to evaluate the quality of the reads ...
-
bioRxiv - Plant Biology 2020Quote: ... A total of 56 samples (Appendix 1) were sequenced together on one lane of 1×75bp NextSeq500 High Output (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Plant Biology 2022Quote: ... We prepare 12 cDNA libraries (3 individuals □ 2 sampling times (dawn and dusk) □ 2 localities) using the TruSeq RNA-seq library prep kit from Illumina (Illumina, Inc., CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: one individual was resequenced by Illumina NovaSeq6000 S4 at Psomagen Inc ...
-
bioRxiv - Microbiology 2021Quote: ... Each pool of V4-V5 16S rRNA amplicons was sequenced (2×300nt paired end) on one lane of a MiSeq V2 sequencer (Illumina, San Diego, CA) at the Carver Biotechnology Center of the University of Illinois ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... one RNA pool of 5 livers from each treatment and sex were independently subjected to sequencing (Illumina Novaseq 6000 paired-end (2×150)) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Samples were 2 × 150 bp paired-end sequenced on one lane each of a HiSeq X Ten instrument (Illumina, Inc., San Diego, CA). Samples for Luke and Nababiep were prepared by HudsonAlpha Institute for Biotechnology (Huntsville ...
-
bioRxiv - Microbiology 2022Quote: ... Australia on one MiSeq V3 system (Illumina) with 2×300bp paired-end reads.
-
bioRxiv - Microbiology 2023Quote: ... Australia on one MiSeq V3 system (Illumina) with 2×300bp paired-end reads.
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced on the iSeq (cases 1 - 6 and controls) or NovaSeq 6000 (case 7 and controls) (Illumina) using 150nt paired-end reads.
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... We used one of the cohorts for our main analyses (AEMS450K1, Athero-Express Methylation Study Illumina 450K 1) and the other smaller cohort for replicating the effect size of methylation sex differences (AEMS450K2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The libraries were quantitated by qPCR and sequenced on one lane for 101 cycles from one end of the fragments on a NovaSeq 6000 (Illumina) using a NovaSeq SP reagent kit and yielded 400 to 500 million single reads per lane ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were pooled and quantified using qPCR and were then sequenced on one S Prime (SP) lane for 101 cycles from one end of the fragments on a NovaSeq 6000 (Illumina). FASTQ files were generated from the raw sequencing runs and demultiplexed with the bcl2fastq v2.20 Conversion Software (Illumina) ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Genomics 2020Quote: ... two NextSeq and one NovaSeq instrument (all Illumina).
-
bioRxiv - Genomics 2020Quote: ... sequenced on one lane of HiSeq X (Illumina). One of the DNA preps inferred to have HMW DNA was used to prepare a linked reads Chromium library (10x genomics ...
-
bioRxiv - Genetics 2022Quote: ... samples were sequenced on one NovaSeq 6000 (Illumina) S4 PE150 flowcell ...
-
bioRxiv - Cell Biology 2023Quote: ... using one lane of an S4 flowcell (Illumina), at the Australian Genome Research Facility (AGRF ...
-
bioRxiv - Bioengineering 2023Quote: ... 10x libraries were pooled and charged with 1% PhiX on one SP lane of the NovaSeq 6000 instrument (Illumina) using the NovaSeq 6000 SP Reagent Kit v1.5 Raw sequencing data of the modules viability study were processed with Cellranger80 ...
-
bioRxiv - Microbiology 2020Quote: ... Shotgun metagenomic libraries were then constructed from a subset of these animals (LDC N = 15, DDC N = 7, CZMD N = 7) using the Nextera XT kit (Illumina, San Diego, CA USA) and sequenced on and Illumina HiSeq 3000 using a 150bp PE sequencing kit (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... by 7 cycles PCR (16S Metagenomic Sequencing Library Preparation, Illumina). The amplicon libraries were purified using Agencourtusing the Agencourt AMPure XP system (Beckman) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The samples were processed using the 10x Genomics Chromium 3’ Gene Expression Solution (version 2) based on manufacturer instructions and sequenced using a NextSeq 500 sequencer (Illumina).
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were constructed with version 2 (stage 16a) or version 3 (stage15 a/b) chemistry and sequenced on a single HiSeqX (Illumina) lane to generate 400-450 million paired-end 150 bp reads (Supplementary Table 4).
-
bioRxiv - Microbiology 2020Quote: ... The obtained partitions were further processed using the Chromium Single Cell 3’ Reagent Kit (version 2, 10x Genomics) to generate Nextera XT sequencing libraries that were sequenced on a HiSeq3000 (Illumina), using a single flow cell lane for each library.
-
bioRxiv - Genomics 2022Quote: ... then single-end sequenced (1 x 100 bp) on one lane using TrueSeq PE150 kit (Illumina, Inc., San Diego, CA) on an Illumina HiSeq 2000 instrument ...