Labshake search
Citations for Illumina :
151 - 200 of 1516 citations for 6H Pyrrolo 3 2 e benzothiazole 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... read length of 2×150 bp (Illumina, USA). In total 183 samples were processed including a melanoma cohort (n= 168) ...
-
bioRxiv - Microbiology 2019Quote: ... paired end reads of 150nt x 2 (Illumina).
-
bioRxiv - Developmental Biology 2019Quote: ... by sequencing (2×75bp) on NextSeq 500 (Illumina).
-
Exploring the microbial diversity in oil-contaminated mangrove sediments using 16S rRNA metagenomicsbioRxiv - Microbiology 2019Quote: ... 2 × 300 bp sequencing process (Illumina, MiSeq V3), and data analysis can be found in our previous articles [12 ...
-
bioRxiv - Genetics 2020Quote: ... 2×150 cycles (Illumina, cat. FC-420-1004), or a Nextseq 500 V2 Mid Output kit ...
-
bioRxiv - Immunology 2021Quote: ... using 2 × 300 bp paired-end kits (Illumina MiSeq Reagent Kit v3 ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end 2×100 bp RNA sequencing (Illumina TruSeq RNA Library Prep Kit ...
-
bioRxiv - Microbiology 2022Quote: ... for 2 × 250 bp paired-end reads (Illumina) for Rm2011 resulting in 4.45 × 106 reads or the MiSeq reagent kit v3 for 2 × 75 bp paired end reads for Rm2011 cya0 resulting in 5.82 × 106 reads ...
-
bioRxiv - Immunology 2022Quote: ... using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... Sequencing (Illumina HiSeq, paired-end, 2×125 bp) was performed by Eurofins Genomics (Ebersberg ...
-
bioRxiv - Neuroscience 2023Quote: ... 2×100 bases paired-end (Novaseq 6000, Illumina).
-
bioRxiv - Genomics 2023Quote: ... and Hi-C (Illumina NovaSeq 6000, 2×150bp) for chromosome-level scaffolding (Fig ...
-
bioRxiv - Bioengineering 2024Quote: ... 10bp (Index i5) and 90bp (Read 2) (Illumina).
-
bioRxiv - Genetics 2024Quote: ... and sequencing (Illumina HiSeq 2 x 150 bp) of the control sample were completed by GENEWIZ (New Jersey ...
-
bioRxiv - Molecular Biology 2020Quote: ... using 2 x 100bp paired-end reads and 2 x 8bp or 2 x 12bp index reads with a 300-cycle kit (Illumina 20012860).
-
bioRxiv - Genomics 2020Quote: ... prior to cluster generation and paired-end short-read high throughput sequencing (2×150bp or 2×250bp) on an Illumina MiSeq or NextSeq550 equipment (Illumina, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: Libraries were prepared using NexteraXT and paired-end sequenced on the MiSeq (v3, 2×300 cycles) or iSeq 100 (I1, 2×150 cycles) platforms according to manufacturer instructions (Illumina Inc). All sequences were deposited in the SRA under accession number PRJNA561185.
-
bioRxiv - Microbiology 2021Quote: ... samples were sequenced on either the Illumina HiSeq 4000 or NextSeq sequencer with 2 × 151 bp or 2 × 76 bp reads (Illumina, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were diluted to 1.8nM and 2×300bp paired-end reads were generated on Illumina MiSeq 2 × 300 bp runs (Illumina, San Diego) by Source Bioscience.
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing was performed using TruSeq 3000 4000 SBS Kit v.3 (Illumina) on the HiSeq 4000 platform (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was prepared with the QuantSeq 3’ mRNA-Seq Library Prep Kit from Illumina following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Library preparation followed the TruSeq mRNA 2 (Illumina, USA) protocol and libraries were sequenced on an Illumina HiSeq 2500 platform (two lanes of 125 bp paired-end sequencing) ...
-
bioRxiv - Genomics 2021Quote: ... and sequenced with NovaSeq 6000 (2×150 bp) (Illumina). DNA was isolated from paired tumor-normal samples also using the AllPrep DNA/RNA/Protein Mini kit ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and TruSeq RNA Sample Preparation Kit version 2 (Illumina) according to the manufacturers’ protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... and sequencing (HiSeq, 2 × 150bp paired end, Illumina®) were performed by GENEWIZ (South Plainfield ...
-
bioRxiv - Genomics 2022Quote: ... following manufacturer’s recommendations and sequenced by Illumina HiSeq 2×150 cycles run (Illumina Inc., CA, USA).
-
bioRxiv - Genomics 2022Quote: ... refringens positive and negative samples were generated for RNAseq library construction and sequencing using the same protocol as described above and sequenced by Illumina HiSeq 2×150 cycles run (Illumina Inc., CA, USA).
-
bioRxiv - Evolutionary Biology 2020Quote: ... franciscae strain CBS2926T (Illumina, PE 2 x 100 bp) were sequenced and assembled at INRAE Montpellier ...
-
bioRxiv - Developmental Biology 2020Quote: ... 12 million 2×150 bp reads (Illumina Nextseq 500) were sequenced for each library.
-
bioRxiv - Genomics 2020Quote: ... PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina; see Supplementary Table 2) were not processed through hybridization and sequencing ...
-
bioRxiv - Immunology 2022Quote: ... and RNA sequencing (Illumina HiSeq, 2 x 150 bp).
-
bioRxiv - Microbiology 2022Quote: ... by 2×150 Paired End (PE) configuration by Illumina HiSeq ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Developmental Biology 2023Quote: ... read 2 - 91 cycles) performed with Nextseq 500 (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... After cluster generation on cBot 2 (Illumina, SanDiego, USA) using the HiSeq 3000/4000 SR Cluster Kit (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... Libraries (2×145 bp Illumina-compatible paired-end reads) were sequenced on a MiSeq® instrument (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA libraries with 2 % spiked-in PhiX control (Illumina) were sequenced at the 100-bp paired end on a P3 flow cell using an Illumina NextSeq2000 instrument at a sequencing depth of ∼80 K reads per cell ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were sequenced using the MiSeq 2×250 bp and HiSeq 2×150 bp paired-end read technology (Illumina, San Diego, CA, USA) as previously described [78] ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Microbiology 2020Quote: ... 3’ adapter sequences from the Illumina TruSeq Small RNA Library Preparation Kit (Illumina, RS-200) were ligated onto the dsRNA species by mixing together 1 μl of adapter with 1 μg dsRNA in a 6 μl reaction and heated at 70°C for 2 minutes ...
-
bioRxiv - Genomics 2022Quote: ... An “A” base was then added to the 3’ end and the adaptor from Illumina was ligated only to one end of the resultant dsDNA as the other end contained a 5’ overhang introduced by the N9 primer ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by A-tailing and ligation at the 3’ ends with paired-end adaptors (Illumina) with a single “T” base overhang ...
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Biochemistry 2023Quote: ... mRNA libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina). Quality of mRNA libraries was determined using Agilent Tape Station and mRNA was sequenced at 75 bp single read sequencing using NextSeq 500 (Illumina).