Labshake search
Citations for Illumina :
1 - 50 of 1749 citations for 6 tert Butyl 4 chlorothieno 2 3 d pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and D (v.2, Illumina) and sequenced on HiSeq4000 and NovaSeq6000 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... The prepared library was sequenced using a MiSeq sequencing system with a V3 reagent kit (300 × 2 bp; Illumina, 4–6 samples). Lake Biwa viral contigs/genomes (LBVs ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Molecular Biology 2021Quote: ... The index sequences were defined by the combination of primers with TruSeq HT index 1 (D 7xx) and TruSeq HT index 2 (D 5xx) (Illumina). Index PCR was performed using KAPA HiFi HS ReadyMix (Kapa Biosystems ...
-
bioRxiv - Microbiology 2023Quote: ... as well as 6 PCR negative control and 3 extraction negatives on a NovaSeq 6000 (Illumina), with 2 Gb requested per sample.
-
bioRxiv - Immunology 2019Quote: ... The indexed samples were multiplexed per 4 or 6 and sequenced on a HiSeq2500 sequencer (Illumina) to produce single-ends 65 bases reads ...
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were 6-plexed and sequenced with 2×100bp reads on a HiSeq-4000 (Illumina). The data were mapped using BWA ...
-
bioRxiv - Physiology 2022Quote: ... Samples were sequenced on the HiSeq 2500 (Figure 2) or NovaSeq 6000 (Figure 6; Illumina) using a 2×100 kit to a read depth >45 million reads/sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... in paired-end mode on Illumina (2×101 bp) using TrueSeq DNA exome kit (v.6) (Illumina Inc.). Paired-end reads were aligned to the human reference genome sequence GRCh38 using BWA–MEM (V0.715-r1140 ...
-
bioRxiv - Genomics 2019Quote: ... RNAseq libraries were pooled and sequenced via single end 50 bp reads on a HiSeq 2500 (4 libraries per lane) or HiSeq 4000 (6 libraries per lane)(Illumina).
-
bioRxiv - Microbiology 2021Quote: ... The sequencing library was prepared using the Nextera XT V.2 Index Kit (Sets A and D, Illumina) according to the Illumina 16S MiSeq Sequencing Library protocol ...
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Plant Biology 2022Quote: ... We prepare 12 cDNA libraries (3 individuals □ 2 sampling times (dawn and dusk) □ 2 localities) using the TruSeq RNA-seq library prep kit from Illumina (Illumina, Inc., CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample.
-
bioRxiv - Physiology 2020Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA-seq libraries were generated using Illumina SureCell WTA 3’ Library Prep Kit for the ddSEQ System (6 cartridge version, cat.no. 20014280, Illumina, San Diego, CA, USA). Libraries were assessed for quality ...
-
bioRxiv - Microbiology 2019Quote: ... set A-D (Illumina). Bead-purified libraries were normalized and pooled (384 samples per run ...
-
bioRxiv - Microbiology 2023Quote: ... C and D (Illumina). Amplicon concentration across samples was normalized to 200 ng/μl using the Qubit high sensitivity dsDNA assay before pooling ...
-
bioRxiv - Molecular Biology 2020Quote: ... Small RNA-seq libraries for 2–4 biological samples were sequenced together using a NextSeq 500 (Illumina) to obtain 75 nt ...
-
bioRxiv - Developmental Biology 2022Quote: ... 75bp single end sequencing was carried out on 4-6 libraries / genotype using Illumina NextSeq500 High output mode and v2.5 chemistry (Illumina Protocol 15046563 v02, Mar 2016) to collect >25M reads per sample.
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Genomics 2019Quote: ... and 800 bp) and four mate-pair libraries (2, 6, 10, and 20 Kb) following the standard protocols provided by Illumina (San Diego, USA). Subsequently ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Cancer Biology 2019Quote: ... The samples were processed using the 10x Genomics Chromium 3’ Gene Expression Solution (version 2) based on manufacturer instructions and sequenced using a NextSeq 500 sequencer (Illumina).
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were constructed with version 2 (stage 16a) or version 3 (stage15 a/b) chemistry and sequenced on a single HiSeqX (Illumina) lane to generate 400-450 million paired-end 150 bp reads (Supplementary Table 4).
-
bioRxiv - Microbiology 2020Quote: ... The obtained partitions were further processed using the Chromium Single Cell 3’ Reagent Kit (version 2, 10x Genomics) to generate Nextera XT sequencing libraries that were sequenced on a HiSeq3000 (Illumina), using a single flow cell lane for each library.
-
bioRxiv - Systems Biology 2024Quote: ... in two growth media conditions (CMAF and Basal)—were profiled by Illumina BeadArrays (mouse WG-6 v2, Illumina). Poor quality profiles were removed ...
-
bioRxiv - Systems Biology 2024Quote: ... Illumina BeadArrays (mouse WG-6, Illumina) were used to profile the transcriptome of 33 independent EpiSC samples ...
-
bioRxiv - Cancer Biology 2019Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were sequenced using 2 x 150 nt paired-end sequencing runs (4 lanes on separate runs) on NextSeq Genome Sequencer (Illumina) with a NextSeq 500/550 High Output Kit v2.5 at Core Facility for Scientific Research – University of Sao Paulo (CEFAP-USP).
-
bioRxiv - Genomics 2023Quote: ... all samples were pooled at 4 nm concentration and paired-end [300bp (2 × 151bp)] sequenced in MiSeq platform (Illumina, USA).
-
bioRxiv - Microbiology 2022Quote: ... Set D (Illumina, San Diego, USA). The sequences of the four sets of primers used during library preparation (limited cycle PCR ...
-
bioRxiv - Microbiology 2023Quote: ... Revision D (Illumina, San Diego, CA) beginning with the Repair Ends step (q.s ...
-
bioRxiv - Immunology 2019Quote: Single-cell RNA-sequencing libraries were generated using the 10x Genomics Single Cell 3’ Solution (version 2) kit and sequenced to an average depth of > 200k reads/cell (Illumina HiSeq 4000). Data analysis was performed using Python3 pipelines (https://github.com/sansomlab/tenx ...