Labshake search
Citations for Illumina :
351 - 400 of 2006 citations for 6 Phenylamino 2 3 dihydro 1H indolizin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... or matched the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Microbiology 2023Quote: ... or matching the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Genetics 2023Quote: ... The final constructed 3’-biased single cell libraries were sequenced by Illumina Novaseq6000 machine ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... distributed over 3 lanes of a HiSeq 2500 with v4 chemistry (Illumina). Sequencing was performed by the Next Generation Sequencing Facility at Vienna BioCenter Core Facilities (VBCF) ...
-
bioRxiv - Plant Biology 2019Quote: ... The Hi-C libraries were sent to the Australian Genome Research Facility (Melbourne, Australia) for sequencing using one lane of 100 bp PE sequencing using a HiSeq2000 (Illumina Inc.).
-
bioRxiv - Plant Biology 2021Quote: One microgram of total RNA was used to generate RNA-seq libraries using TruSeq Stranded mRNA Library Prep Kit (Illumina Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... a total of 2.58 × 108 assembled paired-end reads was obtained as two 33 Gb FastQ files (one file per Illumina-sequence lane). The sequence quality was evaluated by means of the FastQc software (Andrews ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Paired-end sequencing with 150 cycles for each side of the fragments was performed in one lane of the MiSeq® System (Illumina).
-
bioRxiv - Developmental Biology 2021Quote: ... parental DNA was extracted from one individual male and female from tail-fin clip and sequencing library were synthesized with Nextera XT Kit (Illumina, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... The short-read paired-end libraries were sequenced in two independent lanes and the mate-pair library in one lane using the Illumina HiSeq4000 platform (Illumina, USA). The library’s construction and sequencing were performed by Hokkaido System Science Co ...
-
bioRxiv - Genomics 2021Quote: Microarray-derived SNP genotypes were available for 30,499 BSW cattle typed on seven low-density (20k-150k) and one high-density chip (Illumina BovineHD; 777k). Coordinates of the SNP were originally determined according to the ARS-UCD1.2 build ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were then barcoded and pooled into two lanes (eight samples in one and two in another) to generate 100bp paired-end reads on the HiSeq1500 sequencer (Illumina, Inc.).
-
bioRxiv - Neuroscience 2022Quote: ... We pooled up to 12 samples (with different barcodes) in one lane of a flow cell for sequencing (Illumina HiSeq 2500) and used a 150 bp paired-end read configuration ...
-
bioRxiv - Genomics 2022Quote: ... The final Hi-C DNA-Seq library was submitted to Novogene (www.en.novogene.com) for one lane of PE150 Illumina HiSeq X-Ten (Illumina, San Diego, CA, USA) sequencing.
-
bioRxiv - Genomics 2022Quote: ... These products were then used for index PCR using the SI-PCR Primer from the 10X kit for the i5 and one of the small RNA TrueSeq index primers for the i7 (Illumina #15004197).
-
bioRxiv - Evolutionary Biology 2023Quote: ... We then sequenced the entire pooled library on one lane of a NovaSeq6000 SP flowcell (2x150bp; Illumina, Inc. San Diego, CA) at the University of Iowa Institute of Human Genetics.
-
bioRxiv - Genomics 2023Quote: ... Libraries were pooled and sequenced (2x150nt) on one lane of a S1 flowcell on the NovaSeq 6000 (Illumina, San Diego, CA). FastQ files were generated and demultiplexed with the bcl2fastq v2.20 Conversion Software (Illumina).
-
bioRxiv - Systems Biology 2021Quote: ... S4 reagent cartridge (2×100 bp) (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... ADNI GO/2 participants (Illumina HumanOmniExpress BeadChip), and ADNI3 participants (Illumina Omni 2.5M ...
-
bioRxiv - Microbiology 2020Quote: ... and sequencing (2 × 150 bp, Illumina HiSeq) were performed by Genewiz (South Plainfield ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, catalog No. MS-102-2003) by the University of Michigan Microbial Systems Molecular Biology Laboratory as described previously (14) ...
-
bioRxiv - Microbiology 2021Quote: ... 2) merged triplicates for DC3000 + (Illumina only), 3 ...
-
bioRxiv - Microbiology 2022Quote: ... generating 2 × 300bp paired-end reads (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... and sequenced on 2×150 Miseq (Illumina). Clonal abundances were estimated using a pipeline adapted from 110 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or SMART-Seq™ 2 (Illumina, 20040532), followed by NovaSeq (RIP-seq experiments from Figs ...
-
bioRxiv - Immunology 2023Quote: ... and HiSeq2500 V2 2×150bp (Illumina®) protocols at the “Institut du Cerveau” (ICM ...
-
bioRxiv - Genetics 2019Quote: Genotype information was available for 21,001 NTR participants from 6 different genotyping arrays (Affymetrix 6.0 [N = 8,640], Perlegen-Affymetrix [N = 1,238], Illumina Human Quad Bead 660 [N = 1,439] ...
-
bioRxiv - Cell Biology 2023Quote: ... and 20 μM reverse P7 primers with 6-bp TruSeq indices that are automatically demultiplexed by Illumina software ...
-
bioRxiv - Developmental Biology 2022Quote: ... All 6 individual libraries were pooled in equal amount and sequenced with the HiSeq 4000 platoform (Illumina). The RNA-seq data are available under the GEO accession no ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% PhiX control (Illumina, San Diego, CA, USA) along with positive (DNA sample extracted from the healthy gut ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2019Quote: ... Then perform tagmentation using 2 μl of Tn5 transposase and 12.5 ul 2 × TD buffer (Illumina #FC-121-1031) at 37°C for 1h with 650 rpm shaking ...
-
bioRxiv - Plant Biology 2019Quote: ... one DNA library was prepared using the PCR-free TruSeq DNA sample preparation kit following the manufacturer’s instructions (Illumina, San Diego, CA), and sequenced on an Illumina MiSeq instrument (paired-end 2×250bp ...
-
bioRxiv - Cell Biology 2022Quote: ... All four samples underwent 150 base pair (bp) paired-end read sequencing on one lane of an S4 flow cell (Illumina NovaSeq 6000) to a minimum depth of 500 million reads per sample (Source BioScience ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... the two libraries then were pooled with 48 libraries of other projects and subsequently sequenced on 0.09% (L. virgatum) and 0.08% (L. vulgare) of one lane on an Illumina MiSeq system (Illumina, San Diego, California, USA) at the Department of Biochemistry I at the University of Regensburg ...
-
bioRxiv - Genomics 2019Quote: ... as per the manufacturer’s instructions and sequenced on an Illumina NextSeq500 machine with 13 libraries pooled at 1.8 pM using one High Output Kit v2 (Illumina #FC-404-2005) with 75 cycles single-end.
-
bioRxiv - Evolutionary Biology 2022Quote: ... We sent 100 ng to Genome Quebec for paired-end 150bp sequencing on the Illumina HiSeq4000 or the NovaSeqSP 6000 (one library each) following Genome Quebec’s discontinuation of the HiSeq4000 platform (Illumina, San Diego, CA). The NovaSeq sequences the same reads as the HiSeq but at greater read depths ...
-
bioRxiv - Molecular Biology 2023Quote: ... Agilent 2100 Bioanalyzer and ABI Step One Plus Real-Time PCR System were used following the sequencing on the Illumina HiSeqTM4000 system (Illumina, United States). Illumina sequencing was performed at the Beijing Genomics Institute (BGI-Shenzhen ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We sequenced the final pool in one lane at Novogene (Sacramento, CA, U.S.A.) on Illumina HiSeq 150 cycle Paired-End Sequencing v4 runs (Illumina, San Diego, CA, U.S.A.), along with other enriched libraries for unrelated projects ...
-
bioRxiv - Immunology 2021Quote: ... Genotyping of the VRC cohort and imputation of genetic variants are described in detail elsewhere.55 We interrogated 7,637,921 variants (imputed from 2,783,635 genetic variants with a minor allele frequency ≥ 5%, measured using the Illumina Human Omni 5 BeadChip array, GRCh37) for an association with each of the 166 ToxScan peptides using the penalized quasi-likelihood (PQL ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA expression (RNA-Seq level 3 data) and DNA methylation (Illumina HumanMethylation450 array) data of 33 types of cancers (n=10,528 ...