Labshake search
Citations for Illumina :
201 - 250 of 865 citations for 6 Methyl 4 5 6 7 tetrahydrobenzo b thiophene 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2023Quote: ... and the libraries were subjected to 1 × 7 bp high-throughput sequencing by NextSeq 500 (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Plant Biology 2019Quote: ... Libraries were constructed using Illumina TruSeq RNA Single Indexes (Set A and B; Illumina, CA, USA) in a 14-cycle indexing PCR reaction ...
-
bioRxiv - Microbiology 2020Quote: ... B) Informatics benchmarking (‘Experiment 2’) in which a seawater virome was sequenced with short-reads (Illumina) and long-read sequencing ...
-
bioRxiv - Plant Biology 2020Quote: Illumina library preparation followed a modification of the Illumina 16S metagenomic protocol (Illumina #15044223 Rev. B) where all loci specific primers have a 33 bp tail added to the 5’ end ...
-
bioRxiv - Genetics 2023Quote: ... B-allele frequency (BAF) and log-likelihood (LRR) data were generated using GenomeStudio v2.0.5 (Illumina Inc.) with a custom cluster file created according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and the 7 other libraries were single-end sequenced using 50 cycles on a HiSeq2500 sequencer (Illumina) at the IGBMC GenomEast Platform (Illkirch ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Genomic DNA (7 ng) from each sample was first fragmented using a partial Nextera reaction (Illumina, Inc), which also ligates short adapter sequences to the ends of the fragments ...
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp to sufficient read depth with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
bioRxiv - Neuroscience 2020Quote: ... Paired-end 75bp to sufficient read depth with PhiX spike-in controls (7%) (Illumina San Diego, CA).
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
bioRxiv - Genomics 2019Quote: ... to generate ~3 GB data (Illumina, Inc, USA). The total yield of the Number of Paired end was 26,263,128 with the maximum data of 3.78 GB ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Genomics 2023Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µl Tn5 (Illumina) in nuclease-free water or in 50 µl tagmentation mix “Corces et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...
-
bioRxiv - Genomics 2020Quote: ... The B allele frequency (BAF) and the log R ratio (LRR) were extracted from GenomeStudio (Illumina, USA) for representation.
-
bioRxiv - Neuroscience 2020Quote: ... The B allele frequency (BAF) and the log R ratio (LRR) were extracted from GenomeStudio (Illumina, USA) for representation.
-
bioRxiv - Evolutionary Biology 2023Quote: ... cDNA libraries were prepared according to the 16S Metagenomic Sequencing Library Preparation protocol (15044223 Rev. B, Illumina). Libraries were indexed using Nextera XT Index Kit (FC-131-1002/Illumina) ...
-
bioRxiv - Genomics 2019Quote: ... Bead-bound Hi-C DNA was amplified with 7 PCR amplification cycles using PE PCR 1.0 and PE PCR 2.0 primers (Illumina). After PCR amplification ...
-
bioRxiv - Molecular Biology 2023Quote: ... and each sample was sequenced in 3 different lanes (3 technical replicates per sample) on an Illumina HiSeq platform (Illumina, USA).
-
bioRxiv - Systems Biology 2021Quote: ... Libraries were then pooled in groups of 4 and sequenced on 4 lanes on a NextSeq500 sequencer (Illumina) using 10X Genomics recommended reads configuration.
-
bioRxiv - Genomics 2020Quote: ... Log R Ratio and B Allele Frequency were extracted using Genome Studio 2.0 (Illumina, San Diego, California, USA). Data available upon request.
-
bioRxiv - Immunology 2021Quote: ... Paired end reads of 150nt were generated for each B-cell enriched library using the MiSeq sequencer (Illumina). The 5’ gene expression libraries were sequenced following 10X Genomics read length guidelines on the NovaSeq6000 sequencer (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... which were further processed using the 16S Metagenomic Sequencing Library Preparation Protocol (Part No. 15044223 Rev. B – Illumina). Amplifications were carried out using a Verity Thermocycler (Applied Biosystem ...
-
bioRxiv - Immunology 2024Quote: ... The PCR products were then tagged using the Nextera XT Index Kit v2 Sets A to B (Illumina), with the amplicon concentrations normalized to 200 ng/µl via the Qubit high sensitivity dsDNA assay before pooling ...
-
bioRxiv - Microbiology 2020Quote: ... and sequenced to an average depth of 7 gbp per fraction on the Illumina NovaSeq (Illumina, San Diego, CA).
-
bioRxiv - Microbiology 2021Quote: ... The amplicon library was diluted to 7 pM containing 20 % PhiX before sequencing on the MiSeq platform (Illumina, USA) using MiSeq reagent v3 kit to generate 300 bp paired-end reads ...
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...
-
bioRxiv - Neuroscience 2021Quote: ... using TruSeq SR Cluster Kit 3-cBot-HS (Illumina) and TruSeq SBS Kit 3-HS (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Immunology 2024Quote: ... 3 biological replicates were sequenced with NextsSeq 550 (Illumina). For data analysis ...
-
bioRxiv - Developmental Biology 2024Quote: ... library construction was immediately carried out using a Chromium Single Cell 3’ Reagent Kit (Version 3) and sequenced on an Illumina HiSeq 4000 or an Illumina NextSeq2000 (Illumina, cat no. 20040559) by the Technion Medicine Faculty Azrieli-Technion Genomics Center ...
-
bioRxiv - Microbiology 2020Quote: ... Library preparation was carried out according to the MiniSeq System Denature and Dilute Libraries Guide (Protocol A, Illumina b). We combined 500 µL of the denatured and diluted 16S rRNA library (1.8 pM ...
-
bioRxiv - Neuroscience 2022Quote: ... B allele frequency and log R ratio of each single nucleotide polymorphism (SNP) marker were collected from GenomeStudio (Illumina) and analyzed with PennCNV [70] and QuantiSNP [10] with default parameter settings ...
-
bioRxiv - Genomics 2020Quote: ... We performed adapter ligation using Illumina TruSeq Single DNA Indexes Set A and Set B (Illumina, San Diego, USA), and performed adaptor enrichment using (8 ...
-
bioRxiv - Neuroscience 2023Quote: ... and sorted directly into RT Reagent B (10X genomics) and further processed according to the company’s guide and sequenced using a NovaSeq 6000 (Illumina). Commercially available anti-nuclear pore complex proteins antibodies from BioLegends ...
-
bioRxiv - Immunology 2023Quote: ... Spatial transcriptomes were prepared according to the Visisum Protocol CG000239 Rev B: Libraries were sequenced as PE150 by Illumina sequencing to >80% saturation.
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...