Labshake search
Citations for Illumina :
301 - 350 of 888 citations for 6 METHOXY 1 METHYL 1H INDOLE 3 CARBALDEHYDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... with library preparation using the Chromium Next GEM Single Cell 3’ Kit (10x Genomics, PN-1000268) and sequencing was performed on the NovaSeq 6000 (Illumina) by the WSU GSC ...
-
bioRxiv - Cancer Biology 2023Quote: ... Spatially tagged cDNA libraries were constructed with the 10x Genomics Visium Spatial Gene Expression 3’ Library Construction V1 Kit and then sequenced on Novaseq (Illumina)
-
bioRxiv - Genomics 2022Quote: ... Individual libraries were then combined in 3-plex reactions for probe hybridization using oligos from the respiratory panel (Cat No: 20044311, Illumina). The Respiratory Virus Oligo Panel (RVOP ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was prepared using the manufacturers protocol (Chromium Single Cell 3’ reagent kits kit v3, 10x Genomics) and sequenced on a Novaseq 6000 instrument (Illumina). After sample processing and quality control analysis ...
-
bioRxiv - Cell Biology 2023Quote: ... Illumina sequencing libraries were indexed with unique 5’ and 3’ barcode combinations (up to 384 cells) using the Nextera XT DNA library preparation kit (Illumina). Libraries were pooled and size-selected with 0.9X AmpPure XP beads ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA libraries were prepared using the 10X Genomics 3’mRNA-seq workflow (10X Genomics) and sequenced using a NovaSeq instrument (Illumina). Data was processed using CellRanger (10X Genomics ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were processed using the Chromium Next GEM Single Cell 3’ Reagent Kits (10x genomics) and sequenced on a NovaSeq 6000 (Illumina) at the Harvard Medical School Biopolymers Core Facility as 28 (read 1 ...
-
bioRxiv - Microbiology 2023Quote: ... 3-5 µg of each sample was treated with Ribozero® rRNA Removal Kit according to the manufacturer’s instructions (Illumina, USA ...
-
bioRxiv - Microbiology 2023Quote: ... The RNA was dephosphorylated in 3’ and then phosphorylated in 5’ to generate cDNA libraries using the NebNext Small RNA Sample Prep kit with 3’ sRNA Adapter (Illumina) according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Genomics 2023Quote: ... Micro-C libraries (at least 3 per each biological replicate) that passed QC criteria were pooled and paired-end sequenced on a NovaSeq6000 platform (Illumina) to >600 million read pairs per replicate ...
-
bioRxiv - Immunology 2023Quote: ... Single-cell RNA libraries were prepared according to the 10x Genomics Chromium Single Cell 3′ Reagent Kits v2 User Guide and sequenced (paired-end) on a HiSeq 4000 (Illumina).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 3) DNA Sequencing and Genomics Laboratory (BIDGEN): Libraries were prepared using the Nextera™ DNA Flex Library Preparation Kit (Illumina) and sequenced on a NovaSeq6000 to generate 2 x 150 bp reads ...
-
bioRxiv - Genomics 2024Quote: ... 4.5 µl of sample were used to generate single cell RNA-Seq libraries by following the Illumina Bio-Rad SureCell WTA 3’ Library Prep Guide (Illumina, San Diego CA and Bio-Rad ...
-
bioRxiv - Genomics 2024Quote: ... was used for a tagmentation reaction that included 3 µL of 2X TMP buffer and 0.5 µL of Transposome (BLT; CAT # 20015880, Illumina Inc.), incubated in a thermocycler at 53 ℃ for 30 minutes with the lid set at 80 ℃ ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... RNA libraries were prepared using QuantSeq 3’-mRNA Library Prep Kit (Lexogen) and RNA-seq was performed with the NovaSeq 6000 (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Lexogen) and samples were sequenced on the HiSeq4000 (Illumina) in single read mode at the Genomics Core (KU Leuven) ...
-
bioRxiv - Pathology 2024Quote: ... The cDNA libraries were prepared using a Chromium Single Cell 3’ V3 kit (10X Genomics, USA) according to the manufacturer’s instructions and then sequenced on a NovaSeq6000 (Illumina, USA). Raw sequencing reads were aligned to the mm10 (GENCODE vM23/Ensembl 98 ...
-
bioRxiv - Immunology 2021Quote: ... GEX libraries were pooled and sequenced at a depth of approximately 540,000,000 reads per sample in a single S4 flow cell and ADT libraries at a depth of approximately 79,000,000 reads per sample in a single lane of an S4 flow cell on a NovaSeq™ 6000 (Illumina, San Diego, CA; Extended Data Table 6)
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide containing the Illumina P7 adaptor sequence was ligated to the 3’ end of the single stranded LAM PCR fragments using Circligase (Epicentre/Illumina, #CL9025K). A P5 adaptor was added by PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries (1.3 nM) were chemically denatured and applied to an Illumina NovaSeq flow cell using the NovaSeq XP chemistry workflow (Illumina-20021664). Following transfer of the flowcell to an Illumina NovaSeq instrument ...
-
bioRxiv - Neuroscience 2020Quote: ... The cell solutions were immediately transferred to ice and transported to the Wellcome Trust Centre for Human Genetics (WTCHG) for scRNAseq via 10x genomics chromium (10x genomics, US) (Single Cell 3’ v3) and Illumina hiseq 4000 (Illumina, US). This approach achieved 66-72K mean reads per cell and a sequencing depth of 53-55% per cell before filtering.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was extracted and sequence reads (100 bp paired-end) were generated with Illumina TruSeq high output version 3 chemistry on a HiSeq 2500 (Illumina, Inc.) at NRC-Plant Biotechnology Institute (NRC-PBI) ...
-
bioRxiv - Cancer Biology 2020Quote: ... TN5 tagmentation and library amplification realized 3’end fragments by Nextera XT DNA Sample Preparation Kit (Illumina, Cat#FC-131-1024) according to the manufacturer’s instructions while P5_TSO and Nextera_N7xx took the place of the custom primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... 500 ng of total RNA were used as input for QuantSeq (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina; Lexogen) following the autoQuantSeq automated workflow ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) were sequenced using the Illumina MiSeq 2 × 300 bp platform with MiSeq Reagent Kit v3 (Illumina Co.) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were processed according to the standard 10x Chromium 3’ workflow and pooled before sequencing over two lanes (Illumina HiSeq 4000).
-
bioRxiv - Cancer Biology 2019Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters from TruSeq™ Stranded Total RNA Sample Preparation Kit with Ribo-Zero Gold (Illumina) were ligated.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng alkylated RNA was used and prepared with a commercially available kit (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina NovaSeq SP platform in 100bp-single-read mode.
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Genomics 2021Quote: ... and 1µM Dexamethasone or 0.1% ethanol for 3 hours. Transposition was performed using the OmniATAC protocol (Corces et al. 2017) and the tagment DNA TDE1 enzyme (Illumina, 20034197). DNA was purified using the MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: The input samples were submitted to the Washington University Genome Technology Access Center to obtain and sequence the cDNA libraries (10XGenomics, 3’v3.1; Illumina NovaSeq S4) according to established protocols ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 x 105 mESCs and 5 x 104 S2 cells were resuspended in Tagment DNA Buffer and treated with 3 µL TDE1 Tagment DNA Enzyme (Illumina 20034197). After thorough mixing ...
-
bioRxiv - Genomics 2023Quote: For all tandem repeat identification and quantification we used DNA sequences from 2,504 individuals from the Phase 3 of the 1,000 Genomes Project (∼30x coverage Illumina short-read data) (Byrska-Bishop et al ...
-
bioRxiv - Genomics 2023Quote: ... 200ng alkylated RNA were used as input for generating 3’-end mRNA sequencing libraries using a commercially available kit (QuantSeq 3ʹ mRNA-Seq Library Prep Kit FWD for Illumina, Lexogen).
-
bioRxiv - Immunology 2024Quote: ... 2024) using the command CreateSeuratObject with the following parameters: min.cells = 3 and either min.features = 200 (for Illumina reads from MBC gate) or min.features = 100 (for the Oxford Nanopore reads from the ASC gate) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Then the scRNA-seq libraries were constructed by using the Chromium Next GEM Single Cell 3’ Reagent Kits v3 (10X Genomics, USA) and sequenced by using the sequencer Novaseq6000 (Illumina, USA). All procedures were following the manufacturer’s protocol.
-
bioRxiv - Evolutionary Biology 2021Quote: ... we combined 3 μl of each sample (approx 2.24 ng) with a small quantity of a Nextera™ tagment DNA enzyme (Illumina catalogue #15027865). To decrease costs ...
-
bioRxiv - Microbiology 2021Quote: ... The libraries were sequenced using an Illumina MiSeq with MiSeq Reagent Kit v.3 (2x 300 bp, Illumina, San Diego, CA, USA) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... The quantitative 3-step real-time PCR was performed by the Eco Real-Time PCR system (Illumina Inc., San Diego CA, USA) and CFX Connect (Bio-Rad Laboratories AG ...
-
bioRxiv - Genetics 2019Quote: ... with the European individuals from the 1000G phase 3 reference panel and from the Human Genome Diversity Panel data30 (HGDP, Illumina HuHap 650k), to generate four genome-wide SNP datasets analyzed independently.
-
bioRxiv - Immunology 2019Quote: Single-cell RNA-sequencing libraries were generated using the 10x Genomics Single Cell 3’ Solution (version 2) kit and sequenced to an average depth of > 200k reads/cell (Illumina HiSeq 4000). Data analysis was performed using Python3 pipelines (https://github.com/sansomlab/tenx ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA-seq libraries were constructed using a QuantSeq 3’mRNA-Seq Library Prep Kit (LEXOGEN, Vienna, Austria) and sequenced with the NextSeq500 (Illumina, CA, USA) to generate a minimum of two million single-end 75-bp reads ...
-
bioRxiv - Genomics 2021Quote: ... and Reverse primer (5’-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA GGA CTA CHV GGG TAT CTA ATC C-3’) with Illumina sequencing adaptors (Illumina, California, USA). The purified PCR products were then subjected to a multiplexing process using Nextera XT Index kit (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... all of the ChIP DNA and 220 ng of input DNA were mixed with 3 units of T4 DNA polymerase (NEBNext® DNA Library Prep Master Mix Set for Illumina, #E6040L) to create blunt ends ...
-
bioRxiv - Genomics 2023Quote: ... WGS of the samples of Batch 3 was commercially performed by Eurofins (Germany) using Genome Sequencer Illumina NovaSeq platform (Illumina, California, USA) (paired-end 150 bp reads).
-
bioRxiv - Synthetic Biology 2024Quote: ... and a reverse primer annealing to the intronic region directly 3’ of the J segment (PCR1 Rev primer with Illumina adapter overhang). PCRs were performed with Q5 High-fidelity DNA polymerase (NEB ...
-
bioRxiv - Genomics 2020Quote: ... and libraries were constructed by the Lexogen QuantSeq 3’ mRNA-Seq Library Kit FWD (Lexogen, Vienna, Austria).19 All RNA libraries were sequenced by the Illumina HiSeq4000 (Illumina, San Diego, CA). Raw sequencing data were aligned to the reference genome (GRCh37 ...