Labshake search
Citations for Illumina :
51 - 100 of 1116 citations for 6 METHOXY 1 3 BENZODIOXOL 5 AMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Neuroscience 2021Quote: ... a forward primer 5′-CTT TCC CTA CAC GAC GCT CTT CCG ATC TAC GGR AGG CAG CAG-3 (28-nt Illumina adapter (in bold) followed the 14 nt broad range bacterial primer 343F ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA fragments were end-paired and phosphorylated at the 5’ end and successively adenylated at the 3’ end (following Illumina paired-end protocols), and the libraries ligated to the precapture adaptor were amplified and indexed via PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 6) merged triplicates for DC3000 − (Illumina only), 7 ...
-
bioRxiv - Genomics 2019Quote: ... The resulting libraries always contain dual-indexes in the standard indexing positions and may optionally contain additional internal indexes (Figs. 1–3; Table 1; Illumina, 2018b). These indexes are recovered through the four standard separate sequencing reactions generated by Illumina instruments when doing paired-end sequencing (Fig ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced on the iSeq (cases 1 - 6 and controls) or NovaSeq 6000 (case 7 and controls) (Illumina) using 150nt paired-end reads.
-
bioRxiv - Evolutionary Biology 2019Quote: ... we added four mate pair libraries (3 kb, 5 kb, 7 kb, 8 kb) prepared using a Nextera Mate Pair Library Prep kit (Illumina, San Diego, CA, USA). Each library was sequenced on an Illumina HiSeq 2500 sequencer by Novogene (Sacramento ...
-
bioRxiv - Genomics 2019Quote: ... and marker-wise (HWE P value > 1 × 10−6, call rate > 95%, and for the GSA array additionally by Illumina GenomeStudio GenTrain score > 0.6 ...
-
bioRxiv - Genomics 2019Quote: ... was isolated from 1 µg of total RNA and 6 RNA-Seq libraries were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). Libraries were sequenced on an Illumina HiSeq 2000 platform at the Australian Genome Research Facility (AGRF ...
-
bioRxiv - Microbiology 2023Quote: ... Multiplexing of sgRNA challenge screens in BCBL-1 was performed utilizing 6-bp indexes and sequenced on a single lane of a HiSeq4000 (Illumina) using 50bp single-end (SE ...
-
bioRxiv - Cancer Biology 2020Quote: ... and hybridized to BeadChip Array MouseWG-6 (Illumina). Bead chips were scanned with an Illumina BeadArray Reader ...
-
bioRxiv - Systems Biology 2024Quote: ... and hybridized on mouseWG-6 v2 BeadArrays (Illumina). Slides were scanned using an iScan (Illumina SY-101- 1001 ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Neuroscience 2020Quote: ... and hybridized to MouseWG-6 v2.0 Expression BeadChips (Illumina). Raw data were preprocessed with quantile normalization in R/Bioconductor using the package beadarray ...
-
bioRxiv - Genomics 2020Quote: ... sequencing libraries were prepared from 1 ng gDNA using the Nextera XT Library Preparation Kit v.3 (Illumina) and sequenced on the Illumina NextSeq system (paired end 2 x 150 bp insert size) ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Genetics 2020Quote: ... and the libraries were sequenced in pools of 6 (Illumina HiSeq2500 high output flow-cell ...
-
bioRxiv - Cancer Biology 2023Quote: ... Illumina sequencing libraries with 6-bp single indices were constructed from 1 μg total RNA using the TruSeq Stranded mRNA LT kit (Illumina, RS-122-2101). The resulting library was validated using the Standard Sensitivity NGS Fragment Analysis Kit (AATI ...
-
bioRxiv - Genomics 2022Quote: ... We partitioned the genes into three categories: (1) >5-fold higher in Illumina (“Higher count in Illumina”); (2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Molecular Biology 2024Quote: ... CUT&RUN libraries (10–20 Mio reads per sample and 1/3 of reads for the controls) were sequenced on a NovaSeq 6000 (Illumina) paired end 100 bp at the Deep Sequencing Facility (Max Planck Institute for Immunobiology and Epigenetics ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplification was carried out using 3 µl of NMP per sample and adding 1 µl of each dual-indexed (i7 and i5; Illumina) primer ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Molecular Biology 2023Quote: ... Index i7 (6 pb barcode) was read with primer HP8 (Illumina).
-
bioRxiv - Evolutionary Biology 2023Quote: ... 6-digit index primers (Illumina RNA PCR Index Primers RPI1-RPI28) were used instead of 10-digit index primers suggested by the LM-Seq protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was tagmented in 5 technical replicates of 1 ng cDNA each using the Nextera XT Kit (Illumina), according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then lysed and fragmented in a single reaction (12.5 µl 2X Illumina TDE buffer, 2.5 µl 1% Tween-20, 2.5 µl 0.2% Digitonin, 5 µl water, 2.5 µl Illumina TDE1 enzyme). Samples were incubated at 37°C for 60 minutes and purified using the Zymo DNA Clean and Concentrator-5 Kit (Zymo) ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 µL primer P5 (5 µM) and 2.5 µL Index 1 primer (N7**, Illumina, CN FC-131-2001) was used for the PCR enrichment ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Genetics 2021Quote: ... These 6 cats were sequenced on a HiSeq2500 (Illumina, San Diego, CA) to generate 100bp paired-end reads ...
-
bioRxiv - Neuroscience 2019Quote: ... and sequenced 6 samples per lane on a HiSeq 2000 sequencer (Illumina) giving a depth of 30-35 million reads per sample.
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced at 101×6×0×101 on a HiSeq (Illumina) to a minimum depth of 30 million reads per sample.
-
bioRxiv - Immunology 2021Quote: ... and mixed with 6 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96– Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR amplified cDNA libraries were run on 6% Novex TBE gels (Illumina), and fragments running between 110-160 bp markers were gel-extracted for subsequent purification ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... “alata” [6] from NCBI Sequence Read Archive (seven 101bp paired-end Illumina libraries ...