Labshake search
Citations for Illumina :
1 - 50 of 2117 citations for 6 Chloroimidazo 1 2 b pyridazine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were constructed with version 2 (stage 16a) or version 3 (stage15 a/b) chemistry and sequenced on a single HiSeqX (Illumina) lane to generate 400-450 million paired-end 150 bp reads (Supplementary Table 4).
-
bioRxiv - Microbiology 2023Quote: ... with 6 nucleotides library indexes (DNA Single Indexes Set A or B, Illumina). To achieve sufficient variability during the first five sequencing cycles ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genomics 2019Quote: ... Sequencing libraries of A and B containing 6 bp indexes were prepared using the TruSeq RNA sample prep kit (Illumina) following a modification of the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... B) Informatics benchmarking (‘Experiment 2’) in which a seawater virome was sequenced with short-reads (Illumina) and long-read sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... as well as 6 PCR negative control and 3 extraction negatives on a NovaSeq 6000 (Illumina), with 2 Gb requested per sample.
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2022Quote: ... B provided by Illumina technical support ...
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were 6-plexed and sequenced with 2×100bp reads on a HiSeq-4000 (Illumina). The data were mapped using BWA ...
-
bioRxiv - Physiology 2022Quote: ... Samples were sequenced on the HiSeq 2500 (Figure 2) or NovaSeq 6000 (Figure 6; Illumina) using a 2×100 kit to a read depth >45 million reads/sample ...
-
bioRxiv - Microbiology 2021Quote: ... 8) DC3000 − B (Illumina only), 9 ...
-
bioRxiv - Microbiology 2021Quote: ... 4) DC3000 + B (Illumina only), 5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Evolutionary Biology 2021Quote: Tn5ME-B (Illumina FC-121-1031), 59-GTCTCGTGGGCTCGGAGATGTGTA TAAGAGACAG-39
-
bioRxiv - Cancer Biology 2020Quote: ... in paired-end mode on Illumina (2×101 bp) using TrueSeq DNA exome kit (v.6) (Illumina Inc.). Paired-end reads were aligned to the human reference genome sequence GRCh38 using BWA–MEM (V0.715-r1140 ...
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Plant Biology 2022Quote: ... We prepare 12 cDNA libraries (3 individuals □ 2 sampling times (dawn and dusk) □ 2 localities) using the TruSeq RNA-seq library prep kit from Illumina (Illumina, Inc., CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... B and D (Illumina, San Diego, CA). With a final reaction volume of 50 μL ...
-
bioRxiv - Genomics 2022Quote: ... Libraries depleted of ribosomal RNA (figure 2 and 3A-B) were constructed with the TruSeq Total RNA with Ribo Zero plant Kit (Illumina, San Diego, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA-seq libraries were generated using Illumina SureCell WTA 3’ Library Prep Kit for the ddSEQ System (6 cartridge version, cat.no. 20014280, Illumina, San Diego, CA, USA). Libraries were assessed for quality ...
-
bioRxiv - Genetics 2021Quote: ... 6 μL of denatured PhiX control (prepared according to Illumina protocol, final concentration 1%) was added to the library ...
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... The prepared library was sequenced using a MiSeq sequencing system with a V3 reagent kit (300 × 2 bp; Illumina, 4–6 samples). Lake Biwa viral contigs/genomes (LBVs ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Zoology 2020Quote: ... but with TruSeq DNA Single Indexes (Set B, Illumina), following the manufacturers’ instructions up till the adapter ligation step ...
-
bioRxiv - Systems Biology 2019Quote: ... Set B: indexes 13–24 (Illumina, RS-200-0024), Set C ...
-
bioRxiv - Cell Biology 2020Quote: ... and TruSeq RNA Single Indexes Set B (20020493, Illumina) according to standard Illumina library preparation procedure ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6 pM of DNA library spiked with 1% PhiX viral DNA was clustered on cBot (Illumina) and then sequenced on a HiScanSQ module (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced at Novogene on 1 HiSeq PE 150 lane (6 bp, i7 single index, Illumina). The output of the lane was 375 million reads.
-
bioRxiv - Plant Biology 2020Quote: ... Libraries were characterized using an Agilent Technologies 2100 Bioanalyzer and quantified before sequencing using NextSeq500 and 1 x 75 b read chemistry (Illumina).
-
bioRxiv - Genomics 2019Quote: ... and 800 bp) and four mate-pair libraries (2, 6, 10, and 20 Kb) following the standard protocols provided by Illumina (San Diego, USA). Subsequently ...
-
bioRxiv - Cancer Biology 2019Quote: ... The samples were processed using the 10x Genomics Chromium 3’ Gene Expression Solution (version 2) based on manufacturer instructions and sequenced using a NextSeq 500 sequencer (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... The obtained partitions were further processed using the Chromium Single Cell 3’ Reagent Kit (version 2, 10x Genomics) to generate Nextera XT sequencing libraries that were sequenced on a HiSeq3000 (Illumina), using a single flow cell lane for each library.
-
bioRxiv - Systems Biology 2024Quote: ... in two growth media conditions (CMAF and Basal)—were profiled by Illumina BeadArrays (mouse WG-6 v2, Illumina). Poor quality profiles were removed ...
-
bioRxiv - Systems Biology 2024Quote: ... Illumina BeadArrays (mouse WG-6, Illumina) were used to profile the transcriptome of 33 independent EpiSC samples ...
-
bioRxiv - Cancer Biology 2019Quote: ... B with the TruSeq RNA Access Library Prep Kit (Illumina). RNA sequencing was performed in HiSeq 2500 (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... and TruSeq DNA Single Indexes Set A or B (Illumina), excluding the DNA fragmentation and clean-up of fragmented DNA steps ...
-
bioRxiv - Genomics 2019Quote: ... 1 μg DNA aliquots (n=3) were processed for 850K Infinium MethylationEPIC Array (Illumina) as previously described43 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...