Labshake search
Citations for Illumina :
1 - 50 of 2359 citations for 6 CHLORO 2 3 4 9 TETRAHYDRO 1H CARBAZOL 1 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Robust Cancer Mutation Detection with Deep Learning Models Derived from Tumor-Normal Sequencing DatabioRxiv - Genomics 2019Quote: ... and the last one was constructed by combining 9 NovaSeq sequencing replicates from Illumina to get a replicate pair with ∼390× coverage ...
-
bioRxiv - Microbiology 2023Quote: ... The prepared library was sequenced using a MiSeq sequencing system with a V3 reagent kit (300 × 2 bp; Illumina, 4–6 samples). Lake Biwa viral contigs/genomes (LBVs ...
-
bioRxiv - Genomics 2019Quote: ... The pooled library contained three samples at 6 pM with 9% PhiX and was sequenced with a 50-cycle single-end MiSeq reagent kit (Illumina). The sequencing reads were aligned to the reference genome (NC 000913.3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... before combining 6 samples into one flow cell for sequencing on a HiSeq 2000 sequencer (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... 9) DC3000 − C (Illumina only), 10 ...
-
bioRxiv - Microbiology 2019Quote: ... RNA libraries were multiplexed and run across 9 lanes (infected tissues) or 3 lanes (uninfected tissues) for paired end sequencing by Illumina HiSeq 2500 at the University of Wisconsin Biotechnology Center ...
-
bioRxiv - Cancer Biology 2022Quote: ... performed the library preparation for WGS of parental and resistant cells of cell lines #3 and #9 as well as a control tail samples corresponding to line #3 with the TruSeq DNA PCR-free Kit (Illumina) and the 150 bp paired-end sequencing on a HiSeq X (Illumina).
-
bioRxiv - Developmental Biology 2019Quote: ... Up to 6 barcoded samples were pooled in one lane of the flow cell and sequenced by Illumina NextSeq 500 (MidOutput run) ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Plant Biology 2023Quote: Prepared libraries were pooled and diluted to 6 pM for TruSeq Paired End v4 DNA clustering on one single flow cell lane using a cBot device (Illumina). Final sequencing was carried out on an Illumina HiSeq 2500 platform using 126 ...
-
bioRxiv - Microbiology 2020Quote: ... water (n=9) and sediment (n=9) samples were subjected to bacterial 16S rRNA amplicon profiling by Illumina sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... as well as 6 PCR negative control and 3 extraction negatives on a NovaSeq 6000 (Illumina), with 2 Gb requested per sample.
-
bioRxiv - Genetics 2023Quote: ... to 9 uL of FSA (Illumina #20020599). After cDNA synthesis ...
-
bioRxiv - Genomics 2023Quote: We sequenced one elephant reference genome (Em538) to ~60× (2 lanes of Illumina Hiseq X Ten) coverage and eight additional female genomes (4 Asian and 4 African ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Genomics 2019Quote: ... and with short reads using Pilon (two runs; Illumina library; Figure 1h).
-
bioRxiv - Immunology 2019Quote: ... The indexed samples were multiplexed per 4 or 6 and sequenced on a HiSeq2500 sequencer (Illumina) to produce single-ends 65 bases reads ...
-
bioRxiv - Microbiology 2021Quote: ... the pooled library was diluted to 9 pM and spiked with 15% of 9-pM PhiX prepared from PhiX Control Kit v3 (Illumina). The pooled library was then loaded on the MiSeq sequencer (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Genetics 2021Quote: ... Libraries were each sequenced on one full 2 × 150 bp PE (paired end) HiSeq 4000 lane (Illumina).
-
bioRxiv - Microbiology 2019Quote: ... and sequenced with paired-ends (2×125bp) on one lane of an Illumina HiSeq3000 platform (Illumina Inc) at the Norwegian Sequencing Center (NSC ...
-
bioRxiv - Microbiology 2020Quote: ... one PCR reaction of 12 cycles was performed (using 2 µL of 3C library, 0.2 µM Illumina primers PE1.0 and PE2.0 and 1 unit of Taq Phusion [Finnzymes]) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were 6-plexed and sequenced with 2×100bp reads on a HiSeq-4000 (Illumina). The data were mapped using BWA ...
-
bioRxiv - Physiology 2022Quote: ... Samples were sequenced on the HiSeq 2500 (Figure 2) or NovaSeq 6000 (Figure 6; Illumina) using a 2×100 kit to a read depth >45 million reads/sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Plant Biology 2022Quote: ... The GBS library was diluted to 3.6 pM and sequenced on one lane (single end, 101 base pair read length) of an Illumina HiSeq 2500 (Illumina Inc, San Diego, CA) at the Genomics Resources Core Facility (Weill Cornell Medicine ...
-
bioRxiv - Genomics 2023Quote: ... The transposition reaction was incubated for 30 min or 1h at 37◦C (Illumina Tagment DNA Enzyme and Buffer kit ...
-
bioRxiv - Microbiology 2020Quote: ... One paired end sequencing run (2 x 301) was completed on an Illumina MiSeq instrument (Illumina, San Diego, CA) using v3 chemistry ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... All three reactions were pooled in equal-molar ratios and sequenced (paired end 300 bp) on one lane of Illumina MiSeq version 3 chemistry (Illumina, San Diego, California). The final reaction comprising 21 libraries with DNA concentrations 11.4 – 20.0 ng/μl was performed and sequenced as above.
-
bioRxiv - Plant Biology 2021Quote: ... Eighteen libraries differentially indexed using the FastGene Adaptor kit (Nippon Genetics) were multiplexed in one lane and sequenced (2 × 150-bp paired-end reads) on a HiSeq X (Illumina) by GENEWIZ.
-
bioRxiv - Cancer Biology 2020Quote: ... in paired-end mode on Illumina (2×101 bp) using TrueSeq DNA exome kit (v.6) (Illumina Inc.). Paired-end reads were aligned to the human reference genome sequence GRCh38 using BWA–MEM (V0.715-r1140 ...
-
bioRxiv - Genomics 2019Quote: ... RNAseq libraries were pooled and sequenced via single end 50 bp reads on a HiSeq 2500 (4 libraries per lane) or HiSeq 4000 (6 libraries per lane)(Illumina).
-
bioRxiv - Plant Biology 2020Quote: ... A total of 56 samples (Appendix 1) were sequenced together on one lane of 1×75bp NextSeq500 High Output (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Plant Biology 2022Quote: ... We prepare 12 cDNA libraries (3 individuals □ 2 sampling times (dawn and dusk) □ 2 localities) using the TruSeq RNA-seq library prep kit from Illumina (Illumina, Inc., CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample.
-
bioRxiv - Physiology 2020Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample ...
-
bioRxiv - Genomics 2020Quote: one individual was resequenced by Illumina NovaSeq6000 S4 at Psomagen Inc ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA-seq libraries were generated using Illumina SureCell WTA 3’ Library Prep Kit for the ddSEQ System (6 cartridge version, cat.no. 20014280, Illumina, San Diego, CA, USA). Libraries were assessed for quality ...
-
bioRxiv - Genetics 2021Quote: ... 6 μL of denatured PhiX control (prepared according to Illumina protocol, final concentration 1%) was added to the library ...
-
bioRxiv - Microbiology 2021Quote: ... Each pool of V4-V5 16S rRNA amplicons was sequenced (2×300nt paired end) on one lane of a MiSeq V2 sequencer (Illumina, San Diego, CA) at the Carver Biotechnology Center of the University of Illinois ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... one RNA pool of 5 livers from each treatment and sex were independently subjected to sequencing (Illumina Novaseq 6000 paired-end (2×150)) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Samples were 2 × 150 bp paired-end sequenced on one lane each of a HiSeq X Ten instrument (Illumina, Inc., San Diego, CA). Samples for Luke and Nababiep were prepared by HudsonAlpha Institute for Biotechnology (Huntsville ...