Labshake search
Citations for Illumina :
1 - 50 of 1712 citations for 6 Amino 5 2 2 diethoxyethyl 4 hydroxy Pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Microbiology 2023Quote: ... The prepared library was sequenced using a MiSeq sequencing system with a V3 reagent kit (300 × 2 bp; Illumina, 4–6 samples). Lake Biwa viral contigs/genomes (LBVs ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were generated from 2-5 μg of genomic DNA using the TruSeq 2 library preparation kit (Illumina, USA). Two types of libraries were prepared ...
-
bioRxiv - Immunology 2020Quote: ... The enriched B cell libraries were sequenced in NextSeq or MiSeq sequencer using NextSeq Mid Output v2.5 sequencing reagent kit (read length: 2 × 150 bp) or MiSeq Reagent Kit v2 (read length: 2 × 150 bp) (Illumina) respectively.
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were 6-plexed and sequenced with 2×100bp reads on a HiSeq-4000 (Illumina). The data were mapped using BWA ...
-
bioRxiv - Physiology 2022Quote: ... Samples were sequenced on the HiSeq 2500 (Figure 2) or NovaSeq 6000 (Figure 6; Illumina) using a 2×100 kit to a read depth >45 million reads/sample ...
-
bioRxiv - Genomics 2022Quote: ... and DRB3, 4, 5 (exon 2) genes with Fluidigm Access Array (Fluidigm, Singapore) and sequenced on an Illumina MiSeq sequencer (Illumina, San Diego, USA). HLA alleles and genotypes are called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina) were used for construction of complementary DNA libraries and the complementary DNA libraries were sequenced on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 (Illumina) and the HiSeq Rapid SBS Kit v2-HS (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 (Illumina) for the sequencing.
-
bioRxiv - Immunology 2023Quote: ... 2 (Illumina) was the primer source ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Cell Biology 2019Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample.
-
bioRxiv - Physiology 2020Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample ...
-
bioRxiv - Microbiology 2019Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Microbiology 2021Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Cell Biology 2022Quote: ... version 2 (Illumina) using 10 PCR cycles ...
-
bioRxiv - Cancer Biology 2020Quote: ... in paired-end mode on Illumina (2×101 bp) using TrueSeq DNA exome kit (v.6) (Illumina Inc.). Paired-end reads were aligned to the human reference genome sequence GRCh38 using BWA–MEM (V0.715-r1140 ...
-
bioRxiv - Neuroscience 2019Quote: ... Index 2: 8 cycles) across 2 runs on a NextSeq 500 (Illumina) with an average read depth across biological replicates of 8,815 reads per cell.
-
bioRxiv - Genomics 2020Quote: ... 300×2 bp or 150×2 bp (Illumina, Inc., San Diego, CA).
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina, CA, USA). The two types of libraries ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl transposase (Illumina), 10.5 μl nuclease-free water and 0.01% NP-40 ...
-
bioRxiv - Immunology 2021Quote: ... Group 2 (France, Illumina), Group 3 (North America ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, CA, USA). ASVs were inferred using DADA2 v ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 from Illumina libraries.
-
bioRxiv - Molecular Biology 2020Quote: ... Small RNA-seq libraries for 2–4 biological samples were sequenced together using a NextSeq 500 (Illumina) to obtain 75 nt ...
-
A New Gene Set Identifies Senescent Cells and Predicts Senescence-Associated Pathways Across TissuesbioRxiv - Cell Biology 2021Quote: ... and 2-5 cm inferior to the navel.24,38 Sequencing was performed on a HiSeq2000 (Illumina®), fastq files were mapped to the human reference genome hg19 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... High-throughput genome sequencing was performed either on Hiseq 2000 (2 × 100 or 2 × 150 paired-end reads) or Miseq (2 × 300 paired-end reads) sequencer (Illumina, San Diego, CA) following the manufacturer ‘s instruction.
-
bioRxiv - Physiology 2021Quote: ... High-throughput genome sequencing was performed on a HiSeq 2500 (2 × 100 or 2 × 150 paired-end reads) or MiSeq (2 × 300 paired-end reads) sequencer (Illumina, San Diego, CA), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... The 33 samples were combined to 2 pools and sequenced using 2 NovaSeq (Illumina) S4 200 cycle flow cells.
-
bioRxiv - Cell Biology 2020Quote: ... and D (v.2, Illumina) and sequenced on HiSeq4000 and NovaSeq6000 (Illumina ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μl Tn5 enzyme (Illumina), 0.25 μl 1 % digitonin ...
-
bioRxiv - Genomics 2019Quote: ... (2) receptors obtained from Illumina sequencing of the transcriptome of the main olfactory epithelium ...
-
bioRxiv - Genetics 2023Quote: 2×150bp reads from Illumina NovaSeq were obtained for all samples with a minimum depth of 22M reads at Novogene (Beijing ...
-
bioRxiv - Genetics 2023Quote: 2×150bp reads from Illumina NovaSeq were obtained for all samples with a minimum depth of 17 M reads at Novogene (Beijing ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2) Detection from Illumina RNA-seq data through SL leader sequence trimming(43) ...
-
bioRxiv - Cancer Biology 2021Quote: ... on Thermo Fisher Scientific’s Quantstudio 5 before multiplex pooling and sequencing a 2×100 flow cell on the NovaSeq platform (Illumina) at the Collaborative Sequencing Center.
-
bioRxiv - Genomics 2022Quote: ... 5 μl of Index primer (both provided in NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2), and 25 μl NEBNext Ultra II Q5 Master Mix (PCR cycling conditions ...
-
bioRxiv - Microbiology 2019Quote: ... and 2×300bp PE Miseq (Illumina) sequencing at UBC Pharmaceutical Sciences Sequencing Centre (Vancouver ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 × 150 bp flow cells (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... and sequencing (Illumina HiSeq 2 × 150bp) were all performed at GeneWiz ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2% PhiX (PhiX Control v3, Illumina) was spiked into the sample and 20 µL were added to an Illumina iSeq 100 i1 Reagent v2 cartridge ...
-
bioRxiv - Biochemistry 2024Quote: ... Round 2 primers (Illumina TruSeq Adapters) were added to each reaction to 400 nM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2×150 cycle strategy (Illumina Inc.). Paired-end reads were produced with a 100x coverage ...
-
bioRxiv - Genomics 2019Quote: ... and 800 bp) and four mate-pair libraries (2, 6, 10, and 20 Kb) following the standard protocols provided by Illumina (San Diego, USA). Subsequently ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were sequenced using 2 x 150 nt paired-end sequencing runs (4 lanes on separate runs) on NextSeq Genome Sequencer (Illumina) with a NextSeq 500/550 High Output Kit v2.5 at Core Facility for Scientific Research – University of Sao Paulo (CEFAP-USP).
-
bioRxiv - Genomics 2023Quote: ... all samples were pooled at 4 nm concentration and paired-end [300bp (2 × 151bp)] sequenced in MiSeq platform (Illumina, USA).