Labshake search
Citations for Illumina :
301 - 350 of 1533 citations for 5 TERT BUTOXYCARBONYLAMINO 2 CHLORO NICOTINIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5-day deligated samples were sequenced (the ligated sample was sequenced on the Illumina Nextseq500 and all others were sequenced on the Illumina Nextseq2000) ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Microbiology 2023Quote: ... all libraries were spiked with 5% PhiX Control v3 (Illumina, Catalog No. FC-110-3001). The NCBI Genbank accession number for the raw sequencing data reported here is PRJNA999749.
-
bioRxiv - Genomics 2023Quote: ... were dual-indexed using differing barcode indexes both for the forward (5’ P5 Illumina adapter) and reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Genomics 2020Quote: ... De-multiplexing of RNA-Seq reads was conducted using bcl2fastq v.2 (Illumina). Both DNA-Seq and RNA-Seq reads were submitted to FastQC 51 for quality validation.
-
bioRxiv - Molecular Biology 2021Quote: ... 2 × 36 base paired-end sequencing was performed with a NextSeq500 sequencer (Illumina) by Tsukuba i-Laboratory LLP (Tsukuba ...
-
FOXO dictate initiation of B cell development and myeloid restriction in common lymphoid progenitorsbioRxiv - Immunology 2022Quote: ... Libraries were sequenced paired-end (2×50 cycles) on the Illumina platform (Illumina). Reads were mapped using STAR (v 2.5.2b ...
-
FOXO dictate initiation of B cell development and myeloid restriction in common lymphoid progenitorsbioRxiv - Immunology 2022Quote: ... Libraries were sequenced paired-end (2×50 cycles) on the Illumina platform (Illumina). To obtain differential ATACseq peaks ...
-
bioRxiv - Immunology 2021Quote: ... Sequencing had been performed by a 300*2 paired-end kit by Illumina MiSeq ...
-
bioRxiv - Bioengineering 2019Quote: ... and the sequencing was run with a 2×250 bp MiSeq run (Illumina).
-
bioRxiv - Cancer Biology 2019Quote: ... Libraries were sequenced (paired-end, 2 × 75 cycles) on NextSeq platform (Illumina Inc.) Fastq underwent to Quality Control using FastQC tool (https://www.bioinformatics.babraham.ac.uk/projects/fastqc/) ...
-
bioRxiv - Genetics 2021Quote: ... and subjected to 2 × 50-bp paired-end sequencing on Hiseq XTen (Illumina).
-
bioRxiv - Genomics 2021Quote: ... Each batch was sequenced separately on 1-flowcell (2 lanes) HiSeq 2500 (Illumina) Rapid Mode platform with a single-end (1×50 bp ...
-
bioRxiv - Neuroscience 2021Quote: ... The libraries were sequenced paired ended (2×75bp) on the NextSeq500 instrument (Illumina) to an average of at least 33 million reads ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were sequenced 2 * 50+8+16 bp on a HiSeq2500 sequencer (Illumina). RNA-seq data were processed according to Doyle et al ...
-
bioRxiv - Microbiology 2020Quote: ... Read 1 and 2 adapter recognition sequences were provided for adapter removal (Illumina TruSeq Adapter Read 1 ...
-
bioRxiv - Microbiology 2021Quote: ... An Illumina MiSeq Platform (2×300 cycles; Illumina Inc., San Diego, CA, USA) was used for a paired-end sequencing run ...
-
bioRxiv - Systems Biology 2020Quote: ... a 2 x 300 bp paired end library (Illumina Nextera XT DNA kit) was sequenced on a MiSeq ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μg of RNA were treated with “TruSeq RNA sample preparation kit” (Illumina) combined with a specific strand labeling using dUTPs [36] ...
-
bioRxiv - Molecular Biology 2020Quote: ... Paired-end (150 base pairs × 2) sequencing with the NovaSeq 6000 platform (Illumina) was outsourced to Takara Bio ...
-
bioRxiv - Genomics 2020Quote: ... and 2.5μL (20μM) each of 2 indexed primers (Illumina TruSeq Combinatorial Dual (CD) index adapters ...
-
bioRxiv - Plant Biology 2022Quote: ... we obtained 26–30 × pair-end sequencing reads (150 bp × 2) from Illumina HiSeq 2500 (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Pair-ended 2×75 bp sequencing was performed on the NextSeq 500 (Illumina) at Core Unit Systems Medicine ...
-
bioRxiv - Cell Biology 2022Quote: ... WGS paired-end (PE) reads with 2×150bp configuration were obtained from Illumina HiSeq platform and processed using SAMtools (v1.2 ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing was carried out on a Novaseq6000 S2 2×50bp flow cell (Illumina) utilizing the Chromium single-cell 5′ gene expression library preparation (10X Genomics) ...
-
bioRxiv - Genomics 2022Quote: ... SW-8046-2) from libraries prepared using the Nextera XT DNA kit (Illumina, Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... paired-end (2 × 150 bp) sequencing with the Hiseq 4000 platform (Illumina, USA). The resulting FASTQ files were then aligned against the reference genome (Ankara C9 genome) ...
-
bioRxiv - Microbiology 2021Quote: ... and paired-end sequencing (2 x 150 bp) was performed using MiniSeq (Illumina). Illumina paired-end reads were mapped onto the on-site assembly sequences ...
-
bioRxiv - Cancer Biology 2019Quote: ... Paired-end 2×50 bp sequencing was performed using a HiSeq2500 system (Illumina). Sequencing data are available through the NCBI Gene Expression Omnibus (GEO ...
-
bioRxiv - Genomics 2019Quote: ... Paired-end sequencing (2 × 50 nt) was performed on a HiSeq2500 system (Illumina).
-
bioRxiv - Genomics 2019Quote: ... paired-end (2×150bp) sequencing was performed on a NextSeq 550 system (Illumina) with 20 samples on one run in High Output mode ...
-
bioRxiv - Microbiology 2020Quote: ... Paired-end sequencing (2×250 bases) was performed on a HiSeq 2500 (Illumina) using the HiSeq Rapid SBS Kit v2 (500 cycle ...
-
bioRxiv - Physiology 2020Quote: ... Paired-end (2 × 75 bp) sequencing was performed on the HiSeq4000 system (Illumina). Sequencing data were aligned to the human reference genome using the Burrows-Wheeler Aligner (Li & Durbin ...
-
bioRxiv - Cell Biology 2021Quote: ... LT-PTC and pUC using TruSeq mRNA sample prep kit v.2 (Illumina). Sequence alignment and RNA-Seq analysis ...
-
bioRxiv - Microbiology 2019Quote: ... Libraries were sequenced using 2 × 300 bp paired end v3 reagent kit (Illumina). Short read paired-end data was trimmed using TRIMMOMATIC (version 0.35 ...
-
bioRxiv - Microbiology 2019Quote: ... Department of Energy Joint Genome Institute (Illumina NextSeq, 2×151 bp, paired end). Three biological replicates were analyzed per growth condition ...
-
bioRxiv - Bioengineering 2021Quote: ... followed by sequencing using a 2×300 paired end reagent kit (v3, Illumina). For the 3-segment interrogation (Fig ...
-
bioRxiv - Biochemistry 2021Quote: ... primarily as paired end 2×151 read multiplex runs on MiSeq platform (Illumina). We used the ShapeMapper2 algorithm 79 to determine the mutation frequency in both chemically modified (5NIA and DMS treated ...
-
bioRxiv - Genomics 2020Quote: ... The libraries were then prepared and sequenced (2 × 75 bp, paired-end Illumina NextSeq with the first ten bases acting as tags) ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were sequenced pair-end (2×50 cycles) on the Illumina platform (Illumina). Reads were trimmed (using Trim Galore v0.4.1) ...
-
bioRxiv - Microbiology 2021Quote: All SARS-CoV-2 stocks were deep sequenced on a MiSeq platform (Illumina).
-
bioRxiv - Immunology 2020Quote: ... Sequencing is performed using the 2*300 MiSeq Reagent Kit v3 (Illumina, Inc.).
-
bioRxiv - Cell Biology 2021Quote: ... Sequencing of 2×150 bp was performed with a NextSeq 550 sequencer (Illumina) at the sequencing core facility of the Faculty of Medicine (Leipzig University ...
-
bioRxiv - Genomics 2020Quote: 2 × 150-bp pair-end reads deep sequencing data (∼5000X depth) from Illumina platform were converted to fastq format ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 2 µl of Tn5 Transposase (from Nextera XT DNA Prep Kit, Illumina) were added to the lysates ...
-
bioRxiv - Cancer Biology 2022Quote: Paired-end sequencing (2 x 75bp) was performed on a NextSeq 500 (Illumina) with SMART-Seq Stranded Kits (Takara Bio ...
-
bioRxiv - Cancer Biology 2022Quote: ... Hi-C libraries were sequenced 2×150bp on a NovaSeq 6000 instrument (Illumina). Juicer were used to process raw reads and generate Hi-C contact matrices (.hic files) ...
-
bioRxiv - Microbiology 2022Quote: ... Sequencing reactions were carried out using MiSeq v2 (2×150 bp) chemistry (Illumina) on a MiSeq instrument (Illumina ...
-
bioRxiv - Plant Biology 2022Quote: ... and sequencing (paired-end, 2 × 151 cycles, Illumina NovaSeq6000 system at IPK Gatersleben) involved standard protocols from the manufacturer (Illumina Inc. ...