Labshake search
Citations for Illumina :
601 - 650 of 1529 citations for 5 Pyrimidinecarboxaldehyde 2 amino oxime 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: The prepared libraries were sequenced (2×100 bp paired-end sequencing) on the HiSeq 2500 (Illumina) platform ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Microbiology 2023Quote: ... was applied with S2 flow cells and the 2 x 150 bp paired-end kit (Illumina) according to company protocols ...
-
bioRxiv - Plant Biology 2023Quote: ... and sequencing of 2 × 100 bp paired-end reads using the NovaSeq 6000 (Illumina, United States). Obtained raw reads were mapped to strain the V35 genome using Kallist 0.43.1 with the default setting (Bray et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... Paired end sequencing (2 x 150bp) was carried out on an Illumina Nextseq or Novaseq (Illumina).
-
bioRxiv - Systems Biology 2023Quote: They performed 2 × 50 bp paired-end sequencing on the NextSeq 2000 platform (Illumina Inc, #20038897) using NextSeq 1000/2000 P2 Reagents (100 cycles ...
-
bioRxiv - Microbiology 2023Quote: ... All libraries were pooled and sequenced on a NextSeq 2K P1 2×150-bp run (Illumina) with 20% PhiX target spiked in to account for the low diversity of Tn-seq libraries ...
-
bioRxiv - Genomics 2023Quote: ... RNA-seq (2 × 100 nt paired-end reads) was performed using a HiSeq 3000 instrument (Illumina), yielding an average of 38 million reads/sample.
-
bioRxiv - Microbiology 2023Quote: ... 2×125 bp paired-end library preparation and WGS analysis on a HiSeq 2500 platform (Illumina) was performed by BaseClear (Leiden ...
-
bioRxiv - Genomics 2023Quote: ... Pooled libraries were sequenced using the NovaSeq 6000 S4 2×150bp flowcell (Illumina, San Diego, CA) at the Ramaciotti Centre for Genomics (UNSW ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The paired-end sequencing (150 bp × 2) was performed using the Novaseq6000 next-generation sequencer (Illumina). The rRNAs were removed from the total RNAs using the Ribo-Zero Plus rRNA Depletion Kit (Illumina) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sequencing was performed in a 2×75 bp paired-end configuration using a NovaSeq platform (Illumina).
-
bioRxiv - Cell Biology 2024Quote: ... The paired-end WGS (2 x 150 bp) was performed on a NovaSeq 6000 system (Illumina). The bioinformatics analysis of the WGS-based mutation identification was performed according to the MiModD pipeline v0.1.965 by Center for Computational and Systems Biology and Technology Commons at College of Life Science ...
-
bioRxiv - Genetics 2024Quote: ... Libraries were sequenced in 2×38-bp paired-end mode with NextSeq 500 sequencing technology (Illumina), per the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2024Quote: ... This is based on the index-hopping rate of about 0.1-2% as listed by Illumina (https://sapac.illumina.com/techniques/sequencing/ngs-library-prep/multiplexing/index-hopping.html).
-
bioRxiv - Cell Biology 2023Quote: All samples were sequenced 2×80 on a NEXTseq 500 sequencer (Illumina, San Diego, CA, USA) in the Biopolymers Facility at Harvard Medical School ...
-
bioRxiv - Bioengineering 2024Quote: ... Pooled samples were sequenced using MiSeq 2×300 bp paired end reads (Illumina, MS-102-3003).
-
bioRxiv - Genetics 2024Quote: ... followed by paired-end (2□×□100□bp) sequencing using the Illumina HiSeq 4000 Sequencing System (Illumina) at the Beijing Genomics Institute ...
-
bioRxiv - Immunology 2023Quote: ... RNA-seq libraries were sequenced at read lengths 2 × 151bp on the Illumina Novaseq 6000 (Illumina). Aligment was performed using RNA-STAR (2.3.1 ...
-
bioRxiv - Genetics 2021Quote: ... The pellet was resuspended in 10 µL of transposition mixture (5 µL TD buffer, 3.2 µL PBS, 0.89 µL Tn5 (Illumina, 20034197), 0.1% Tween-20 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Genomics 2019Quote: ... Nuclei were collected and subject to tagmentation at 37 °C for 30 minutes in adjusted tagmentation buffer (2x TD Tagment buffer + Digitonin 0.01% + 5 ul of TDE Tagment DNA enzyme from Illumina). Reaction was stopped with 0.2% SDS and DNA was collected using Qiaquick PCR purification columns and eluted in 10 μl 10 mM Tris ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing libraries were prepared according to the TruSeq stranded mRNA library preparation kit (Illumina, Inc., Cat No.20020594/5) including poly-A selection ...
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704 ...
-
bioRxiv - Genetics 2019Quote: ... We tagmented 5 ng of cDNA using 1 uL Nextera Tagment DNA Tn5 transposase (Illumina, San Diego, CA, 15027916) in a 10 uL tagmentation mix for 10 minutes at 55 °C.
-
bioRxiv - Genetics 2020Quote: ... Globin and rRNA sequences were depleted from up to 5 µg of treated RNA using Globin-Zero Gold (Illumina), before PolyA selection with NEBNext Poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... 5 µg fragmented RNA was used for ribosomal RNA removal using Ribo-Zero Gold rRNA Removal Kit (MRZG12324 Illumina) according to Illumina’s protocol for TruSeq Ribo Profile Kit (RPHMR12126 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL of the sample was then further diluted and denatured with 5 µL 0.1N NaOH and 490 µL HT1 buffer (Illumina). Samples were sequenced on a HiSeq2500 HighOutput (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of the 4nM library pool was denatured with 5 μl 0.2N of NaOH and diluted using the HT1 Hybridization Buffer (Illumina) to a concentration of 8 pM for amplicon samples and 10 pm for whole-genome samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The chromatin was then tagmented by resuspending beads in 29 µl Tagmentation Buffer (10 mM Tris-HCl pH 8.0, 5 mM MgCl2, 10% dimethylformamide) and adding 1 µl of transposase (Illumina). Samples were incubated at 37 °C for 10 min and the reaction was terminated by adding 150 µl RIPA buffer ...
-
bioRxiv - Pathology 2022Quote: ... Finally, the libraries of multiplexes (control, 5 samples; schizophrenia, 10 samples) were pooled and analyzed using Illumina HiSeq1500 (Illumina).
-
bioRxiv - Genetics 2022Quote: ... Nuclei pellet was obtained by centrifugation at 500g for 5 minutes at 4 degrees and resuspended in 100μl ice-cold 1x TD buffer (20034198, Illumina). About 10K nuclei was used for transposition reaction at 37 degrees for 30 minutes in a thermomixer ...
-
bioRxiv - Genetics 2020Quote: ... and IV-5) individuals were genotyped using the Infinium Global Screening Array-24 v1.0 BeadChip (Illumina, SanDiego, CA, USA) according to manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dual indexed sequencing libraries were made out of 5 ng cDNA from the above preparations using Illumina Nextera library preparation kit according to manufacturer’s instructions (Illumina). Quality checked and equimolar pooled libraries were sequenced in a HiSeq 4000 Illumina system ...
-
bioRxiv - Cell Biology 2020Quote: ... rRNA was depleted from 5 μg of total RNA using the Ribo-Zero Gold Yeast rRNA Removal Kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... since values ΔCq > 5 are not suitable for further downstream processing for Infinium HD FFPE Restore Protocol (Illumina, Inc.) and Infinium MethylationEPIC array (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... Ribosomal RNA (rRNA) was depleted from 5 ug of total RNA using the Ribo-ZeroTM Gold Kit (Illumina, Inc). Depleted mRNA was fragmented and converted to first-strand cDNA using Superscript III reverse transcriptase (Invitrogen) ...
-
bioRxiv - Genomics 2021Quote: ... and 5K samples were resuspended in 50 μl, 10 μl, and 5 μl of transposition mix (25 μl 2x TD buffer, 2.5 μl Tn5 (Illumina), 16.5 μl PBS (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: Gene expression data was generated with the Chromium Single Cell 5’ v3.1 assay (10X Genomics) and sequenced on the NovaSeq 6000 platform (S1 flow cell, Illumina). To generate gene-barcode count matrices ...
-
bioRxiv - Physiology 2024Quote: ... tagmented DNA was amplified by PCR in a reaction mix (5 µL DNA, 2.5 µL of 25 μM forward primer (Nextera/Illumina i5 adaptors (Illumina)) ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were equimolarly pooled and 1.8 pM of the pool with 5% PhiX were loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Plant Biology 2020Quote: 126 cDNA libraries were prepared using the Illumina TruSeq RNA Sample Preparation Kit v.2 (Illumina, USA) from isolated RNA ...
-
bioRxiv - Plant Biology 2020Quote: ... where they were sequenced on a MiSeq instrument in paired-end 2 × 300 bp mode (Illumina, USA). The raw sequencing data was deposited at the European Nucleotide Archive (http://www.ebi.ac.uk/ena) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and were sequenced on the Illumina NovaSeq (>70 million 2×150 bp sequences) (Illumina, San Diego, CA).
-
bioRxiv - Developmental Biology 2021Quote: ... Paired-end 2 x 75 bp NSQ 500/550 Hi Output KT v2.5 −75 CYS (Illumina, 20024906) was performed for RNA-seq libraries on an Illumina Nextseq 500 instrument ...