Labshake search
Citations for Illumina :
101 - 150 of 1035 citations for 5 OXO 5 6 7 8 TETRAHYDRO NAPHTHALENE 1 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7), with both containing 8N barcodes for multiplexing.
-
bioRxiv - Cancer Biology 2022Quote: ... All of the 3′ and 5′ flowcells were demultiplexed with bcl2fastq (Illumina). FASTQ files were processed with Cell Ranger v7.0.1 (10x Genomics) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 cycles of amplification at PCR1 (addition of Illumina adapters and indexes), 12 cycles of amplification at PCR2 (final RNA-seq library amplification ...
-
bioRxiv - Cell Biology 2023Quote: ... with a 5% spike-in of PhiX v3 (Illumina FC-110-3001).
-
bioRxiv - Systems Biology 2023Quote: ... 62 °C for 5 min) using Nextera i5/i7 indexing primers (Illumina) and 2x KAPA HiFi HotStart ready-mix (KAPA Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... with a 5% spike-in of PhiX v3 (Illumina, FC-110-3001).
-
bioRxiv - Genetics 2024Quote: ... 800 ng of total RNAs were treated with 5’-polyphosphatase (Epicenter/Illumina) for 30 min ...
-
bioRxiv - Physiology 2024Quote: ... supplemented with 5% v/v TDE1 Tagment DNA Enzyme (Illumina, Cambridge, UK) in nuclease free water (Sigma ...
-
bioRxiv - Microbiology 2021Quote: ... 7) DC3000 − A (Illumina only), 8 ...
-
bioRxiv - Immunology 2020Quote: ... The 5’gene expression libraries were sequenced in NextSeq or NovaSeq6000 sequencer (Illumina) using NextSeq 500/550 v2.5 sequencing reagent kit (read length ...
-
bioRxiv - Genomics 2019Quote: ... Each well was then mixed with 5 μL Nextera™ TD buffer (Illumina) and 1 μL i7 only TDE1 enzyme (25 nM ...
-
bioRxiv - Immunology 2019Quote: ... 0.01% digitonin and 5 μl of Tn5 from the Nextera kit from Illumina, Cat ...
-
bioRxiv - Immunology 2021Quote: ... 0.01% digitonin and 5 μl of Tn5 from the Nextera kit from Illumina, Cat ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: ... 5 µl nuclease and 2.5 µl Tn5 transposase enzyme (TDE1, Illumina, catalog # 15027865) and incubated for 28 minutes at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... the 5’ Illumina adapter (as used in the Illumina TruSeq Small RNA kit) and a split 2x 3 nt Unique Molecular Identifier (UMI ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli transposition assays were mixed with 5 µL of tagmentation DNA buffer (Illumina) and 1 µL of amplicon tagmentation mix (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... with a loading sample concentration of 10pM and a 5% PhiX (Illumina, U.S.) spike-in ...
-
bioRxiv - Cell Biology 2019Quote: ... The libraries were sequenced in 1 x 100 +7 manner on HiSeq 2000 platform (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries from 7 independent SCL-exo experiments were sequenced on 7 lanes of a HiSeq 1500 (Illumina) by the GEH facility (Rennes ...
-
bioRxiv - Genetics 2023Quote: ... and the libraries were subjected to 1 × 7 bp high-throughput sequencing by NextSeq 500 (Illumina).
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µg of total cellular RNA was depleted of ribosomal RNA (RiboZero kit, Illumina), and subjected to base hydrolysis ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Diluted libraries were spiked with 5% Phi-X control (Illumina, San Diego, CA, USA) and sequenced using the Illumina MiSeq (Illumina Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: ATAC-seq was conducted on 5×104 live cells using Nextera Tn5 transposase (Illumina) as previously described (Buenrostro et al. ...
-
bioRxiv - Immunology 2022Quote: ... 5’ expression library was sequenced with NovaSeq 6000 S1 (100 cycles) (Illumina, cat. 20012865) and the V(D)J library was sequenced with NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 U of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 μl and incubated at 25°C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 units of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 µl and incubated at 25°C for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 µL of the Illumina PCR Primer Cocktail (PPC, Illumina FC-121-1030). PCR conditions were as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Primer Cocktail (Nextera DNA Sample Preparation Kit and Nextera Index Kit, Illumina). Amplification was performed in a Veriti 96 Well Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library amplification was performed using 5 μL Nextera XT i7 forward index primer (Illumina) and 5 μL custom i5 index primers (2 μM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Molecular Biology 2020Quote: ... 12 times 8 Nextera (Illumina) based primer combinations were used ...
-
bioRxiv - Microbiology 2021Quote: ... 8) DC3000 − B (Illumina only), 9 ...
-
bioRxiv - Immunology 2021Quote: ... DRB3/4/5 kits) for sample library preparations and ran on a Miseq sequencer (Illumina), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2021Quote: ... with the libraries clustered at 12-15pM and mixed with 5% PhiX genomic DNA (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were diluted and mixed with 5-20% phiX control v3 (Illumina FC-110-3001) and sequenced with oSK326 for read 1 and oSK324 for the index read.
-
bioRxiv - Cell Biology 2023Quote: ... and 5-day deligated samples were sequenced (the ligated sample was sequenced on the Illumina Nextseq500 and all others were sequenced on the Illumina Nextseq2000) ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Microbiology 2023Quote: ... all libraries were spiked with 5% PhiX Control v3 (Illumina, Catalog No. FC-110-3001). The NCBI Genbank accession number for the raw sequencing data reported here is PRJNA999749.
-
bioRxiv - Genomics 2023Quote: ... were dual-indexed using differing barcode indexes both for the forward (5’ P5 Illumina adapter) and reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Genetics 2021Quote: ... 6 μL of denatured PhiX control (prepared according to Illumina protocol, final concentration 1%) was added to the library ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the resulting nuclear pellet was resuspended in 5 µl buffer TD (Illumina, San Diego, CA) and combined with 2.5 µl H2O and 2.5 µl Tn5 transposase (Tagment DNA Enzyme ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μg DNase-treated RNA was used as input for ribosomal depletion using the Epicentre (Illumina) Ribo-Zero ribosomal depletion kit (Cat# SCL24H) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified mRNA 5′ end libraries were multiplexed again and then sequenced on HiSeq 4000 (Illumina) using paired-end (2x 100 cycles ...
-
bioRxiv - Developmental Biology 2022Quote: ... Completed libraries were pooled in an equimolar ratio along with 5% PhilX Control Library V3 (Illumina), denatured and diluted to 2.0pM as per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... parental fish were whole-genome sequenced with 5–10X coverage (Illumina Hiseq platforms, BGI Hong Kong). The genotyping of F1 fish was carried out with the DarTseq technology (Diversity Arrays Technology ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the resulting nuclear pellet was resuspended in 5 µl buffer TD (Illumina, San Diego, CA) and combined with 2.5 µl H2O and 2.5 µl Tn5 transposase (Tagment DNA Enzyme ...
-
bioRxiv - Molecular Biology 2020Quote: ... the NEBNext Ultra II DNA Library Preparation kit was used to generate libraries using 5-10 ng of input or immunoprecipitated DNA and barcode adaptors (NEBNext Multiplex Oligos for Illumina (Set 1, E7335 and Set 2, E7500)) ...