Labshake search
Citations for Illumina :
101 - 150 of 307 citations for 5 NITROFURFURYL ALCOHOL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Microbiology 2023Quote: ... all libraries were spiked with 5% PhiX Control v3 (Illumina, Catalog No. FC-110-3001). The NCBI Genbank accession number for the raw sequencing data reported here is PRJNA999749.
-
bioRxiv - Genomics 2023Quote: ... were dual-indexed using differing barcode indexes both for the forward (5’ P5 Illumina adapter) and reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the resulting nuclear pellet was resuspended in 5 µl buffer TD (Illumina, San Diego, CA) and combined with 2.5 µl H2O and 2.5 µl Tn5 transposase (Tagment DNA Enzyme ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μg DNase-treated RNA was used as input for ribosomal depletion using the Epicentre (Illumina) Ribo-Zero ribosomal depletion kit (Cat# SCL24H) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified mRNA 5′ end libraries were multiplexed again and then sequenced on HiSeq 4000 (Illumina) using paired-end (2x 100 cycles ...
-
bioRxiv - Developmental Biology 2022Quote: ... Completed libraries were pooled in an equimolar ratio along with 5% PhilX Control Library V3 (Illumina), denatured and diluted to 2.0pM as per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... parental fish were whole-genome sequenced with 5–10X coverage (Illumina Hiseq platforms, BGI Hong Kong). The genotyping of F1 fish was carried out with the DarTseq technology (Diversity Arrays Technology ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the resulting nuclear pellet was resuspended in 5 µl buffer TD (Illumina, San Diego, CA) and combined with 2.5 µl H2O and 2.5 µl Tn5 transposase (Tagment DNA Enzyme ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 pM of DNA library spiked with .5% PhiX viral DNA was clustered on cBot (Illumina) and then sequenced on a HiScanSQ module (Illumina).
-
bioRxiv - Genetics 2021Quote: ... We find that even sequencing error rates as high as 5% (50x higher than Illumina sequencer error) have very little effect on clustering quality under most correlation cut-offs ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were sequenced (5’ single end; single-end 75x) using the NextSeq500 high-throughput sequencing system (Illumina) at the Cornell University Biotechnology Resource Center ...
-
bioRxiv - Developmental Biology 2019Quote: ... Pools of 4 or 5 multiplexed libraries were loaded per lane of a HiSeq 2000 sequencer (Illumina) at 8 pM and single-end sequenced using the 100 bp protocol.
-
A New Gene Set Identifies Senescent Cells and Predicts Senescence-Associated Pathways Across TissuesbioRxiv - Cell Biology 2021Quote: ... and 2-5 cm inferior to the navel.24,38 Sequencing was performed on a HiSeq2000 (Illumina®), fastq files were mapped to the human reference genome hg19 ...
-
bioRxiv - Cell Biology 2021Quote: ... The purified DNA was PCR amplified for 5 cycles using a Nextera DNA Library Index kit (Illumina) and Phusion HF Master Mix (New England BioLabs ...
-
bioRxiv - Microbiology 2020Quote: ... was performed with ~5 million reads / sample in single-end mode on the NextSeq 500 platform (Illumina), using the High Output Kit v2.5 (75 cycles) ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 5 μg total RNA samples were treated with the Ribo-Zero™ rRNA removal procedure (Illumina) to enrich for mRNA ...
-
bioRxiv - Microbiology 2020Quote: ... cells were lysed in ATAC lysis buffer for 5 min and then transposed with TN5 transposase (Illumina) for 30 min ...
-
bioRxiv - Genomics 2022Quote: ... We partitioned the genes into three categories: (1) >5-fold higher in Illumina (“Higher count in Illumina”); (2 ...
-
bioRxiv - Biochemistry 2020Quote: 5 µg total RNA isolated from Flag elution samples were treated with Yeast RiboZero Gold (Illumina, MRZY1306) according to the manufacturer’s instructions to remove yeast rRNAs from the samples ...
-
bioRxiv - Genomics 2021Quote: ... Nuclear isolation of 5×10^4 cells was followed by treatment with Nextera Tn5 enzyme (Illumina, 20034198) for 45 minutes at 37°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... The 5’GEX libraries were sequenced each of on a separate lane of HiSeq4000 flow cell (Illumina) to target sequencing depth of 50,000 read pairs per sample ...
-
bioRxiv - Immunology 2022Quote: ... cells were lysed in ATAC lysis buffer for 5 minutes and then transposed with TN5 transposase (Illumina) for 30 minutes at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Approximately 5 μg total RNA samples were treated with the Ribo-Zero™ rRNA removal procedure (Illumina) to enrich for mRNA ...
-
bioRxiv - Plant Biology 2022Quote: ... and 5 mM β-mercaptoethanol) and then subjected the nuclei to a transposition reaction with Tn5 (Illumina). The transposition reaction was performed with 25 μl of 2x DMF (66 mM Tris-acetate pH 7.8 ...
-
bioRxiv - Microbiology 2023Quote: ... Approximately 5 million 75-nt single reads per sample were determined using a NextSeq High Output (Illumina), with >96% of the reads having a Q30 quality.
-
bioRxiv - Cancer Biology 2023Quote: ... Samples that qualified (RIN>5) were prepped using the standard protocol for Illumina Stranded mRNA prep (Illumina). Sequencing was done using the Illumina NextSeq 2000 with paired-end 59 bp × 59 bp reads ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was tagmented in 5 technical replicates of 1 ng cDNA each using the Nextera XT Kit (Illumina), according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and 5’-end RNA-seq library preparation using tagmentation-based modified Nextera XT DNA sample Preparation kit (Illumina). Libraries were tagged with a plate-specific i7 index and were pooled for sequencing on an Illumina NextSeq2000 platform ...
-
bioRxiv - Genomics 2019Quote: ... and reverse transcribed using 25 pmol RT primer (5’-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3’) for TRU-seq barcodes (RP1 primer, Illumina). A portion of the RT product was removed and used for trial amplifications to determine the optimal number of PCR cycles ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5’-end RNA-seq library preparation using tagmentation-based modified Nextera XT DNA sample Preparation kit (Illumina). Libraries were tagged with a plate-specific i7 index and were pooled by batches of 4-9 plates for sequencing on an Illumina NextSeq550 platform ...
-
bioRxiv - Microbiology 2021Quote: ... 5 ng of DNA was used as input to create Illumina sequencing libraries using the Nextera kit (Illumina). The samples were pooled and sequenced on an Illumina NextSeq 500 High Output system to obtain 2×150 bp reads ...
-
bioRxiv - Bioengineering 2021Quote: ... Additional adapters at 5’-end (P5 and SP1) and 3’-end (P7 and SP2) were designed by Illumina for sequencing purpose ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then lysed and fragmented in a single reaction (12.5 µl 2X Illumina TDE buffer, 2.5 µl 1% Tween-20, 2.5 µl 0.2% Digitonin, 5 µl water, 2.5 µl Illumina TDE1 enzyme). Samples were incubated at 37°C for 60 minutes and purified using the Zymo DNA Clean and Concentrator-5 Kit (Zymo) ...
-
bioRxiv - Microbiology 2019Quote: ... 5-minute elongation step at 72°C was performed on a MiSeq system (Illumina Inc, San Diego, California). After amplification ...
-
bioRxiv - Plant Biology 2020Quote: ... custom adapters for selecting 5’-P mRNAs and primers from the TruSeq Small RNA Sample Preparation Kit (Illumina) for multiplexing the libraries as indicated in Zhai et al (2014) ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Tagment DNA Enzyme and 20 μl nuclease free water (Nextera DNA Sample Preparation Kit, Illumina, UK) for 45 min at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... The library was diluted to a final concentration of 7 pM and 5% of PhiX DNA (Illumina, USA) was added ...
-
bioRxiv - Microbiology 2021Quote: ... Amplicon libraries were mixed with 5% PhiX and sequenced with four MiSeq reagent kits v2 500 cycles (Illumina). A blank extraction kit control ...
-
bioRxiv - Immunology 2021Quote: ... The 5’ gene expression libraries were sequenced following 10X Genomics read length guidelines on the NovaSeq6000 sequencer (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... 2.5 µL primer P5 (5 µM) and 2.5 µL Index 1 primer (N7**, Illumina, CN FC-131-2001) was used for the PCR enrichment ...
-
bioRxiv - Systems Biology 2022Quote: ... were lysed and transposed simultaneously in 25 µl of transposition mix (0.1% NP40, 0.1% Tween-20, 0.01% digitonin and 5% Tn5 enzyme (Illumina # 15027865) in Tagment DNA Buffer (FC-121–1030 ...
-
bioRxiv - Systems Biology 2023Quote: ... 200-500 ng DNA was used for genotyping using the Infinium Omni2.5-8v1-4 and the Infinium Omni2.5-8v1-5 Genotyping BeadChip (Illumina) at the UCSD IGM core ...
-
bioRxiv - Microbiology 2023Quote: ... Fastq files for 5′ libraries sequenced with the extended R1 strategy were generated using bcl2fastq v2.20.0 (Illumina, Inc). Extended R1 fastqs were then separated into “pseudo R1” fastqs ...
-
bioRxiv - Cell Biology 2023Quote: ... The amplified DNA was then pooled to a 10 nM final concentration followed by a 5% PhiX (Illumina) spike and sequenced in a PE100 run on a HiSeq 4000 sequencer (Illumina ...
-
bioRxiv - Systems Biology 2023Quote: ... approximately 5×104 cells were lysed and transposed reactions were carried out using Tn5 Transposase (Illumina, #FC121-1030) at 37 °C for 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... sgRNA inserts were PCR amplified (primers listed in Supplementary Table 5, purified and sequenced on a NextSeq (Illumina). Sequencing reads were mapped and the abundance of each sgRNA was tallied ...
-
bioRxiv - Cancer Biology 2021Quote: ... on Thermo Fisher Scientific’s Quantstudio 5 before multiplex pooling and sequencing a 2×100 flow cell on the NovaSeq platform (Illumina) at the Collaborative Sequencing Center.
-
bioRxiv - Genetics 2021Quote: ... The pellet was resuspended in 10 µL of transposition mixture (5 µL TD buffer, 3.2 µL PBS, 0.89 µL Tn5 (Illumina, 20034197), 0.1% Tween-20 ...