Labshake search
Citations for Illumina :
101 - 150 of 1576 citations for 5 FLUORO 2 PHENYLBENZO D THIAZOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Neuroscience 2019Quote: ... using 2 × 75bp paired-end reads and 2 × 8bp index reads with a 200 cycle kit (Illumina, 20012861). Samples were sequenced at an average of 1.5M reads per cell.
-
bioRxiv - Neuroscience 2019Quote: ... using 2 × 75bp paired-end reads and 2 × 8bp index reads with a 200 cycle kit (Illumina, 20012861). Samples were sequenced at an average of 1.5M reads per cell.
-
bioRxiv - Systems Biology 2021Quote: ... S4 reagent cartridge (2×100 bp) (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... ADNI GO/2 participants (Illumina HumanOmniExpress BeadChip), and ADNI3 participants (Illumina Omni 2.5M ...
-
bioRxiv - Microbiology 2020Quote: ... and sequencing (2 × 150 bp, Illumina HiSeq) were performed by Genewiz (South Plainfield ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, catalog No. MS-102-2003) by the University of Michigan Microbial Systems Molecular Biology Laboratory as described previously (14) ...
-
bioRxiv - Microbiology 2021Quote: ... 2) merged triplicates for DC3000 + (Illumina only), 3 ...
-
bioRxiv - Microbiology 2022Quote: ... generating 2 × 300bp paired-end reads (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... and sequenced on 2×150 Miseq (Illumina). Clonal abundances were estimated using a pipeline adapted from 110 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or SMART-Seq™ 2 (Illumina, 20040532), followed by NovaSeq (RIP-seq experiments from Figs ...
-
bioRxiv - Immunology 2023Quote: ... and HiSeq2500 V2 2×150bp (Illumina®) protocols at the “Institut du Cerveau” (ICM ...
-
bioRxiv - Immunology 2022Quote: ... All BCR enriched V(D)J libraries were pooled together and sequenced on a NextSeq500 (Illumina) using the same parameters as previously mentioned.
-
bioRxiv - Physiology 2021Quote: ... and the combination of 384 Unique Dual Indexes (Illumina-Set A to D, Ref. 20027213-20027216). Using the Mosquito HV robot ...
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% PhiX control (Illumina, San Diego, CA, USA) along with positive (DNA sample extracted from the healthy gut ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2019Quote: ... Then perform tagmentation using 2 μl of Tn5 transposase and 12.5 ul 2 × TD buffer (Illumina #FC-121-1031) at 37°C for 1h with 650 rpm shaking ...
-
bioRxiv - Immunology 2021Quote: ... Genotyping of the VRC cohort and imputation of genetic variants are described in detail elsewhere.55 We interrogated 7,637,921 variants (imputed from 2,783,635 genetic variants with a minor allele frequency ≥ 5%, measured using the Illumina Human Omni 5 BeadChip array, GRCh37) for an association with each of the 166 ToxScan peptides using the penalized quasi-likelihood (PQL ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Pathology 2019Quote: ... Amplicons were then indexed using the Nextera XT Index Kit V2 set A and set D (Illumina) and purified again with AMPure XP beads to remove low molecular weight primers and primer-dimer sequences ...
-
bioRxiv - Immunology 2023Quote: ... V(D)J region-enriched libraries were pooled and sequenced using the NovaSeq 6000 Sequencing System (Illumina).
-
bioRxiv - Genomics 2020Quote: ... Libraries were subsequently sequenced (2 x 150 bp or 2 x 200 bp paired-end reads) using a MiSeq (Illumina) equipment.
-
bioRxiv - Synthetic Biology 2022Quote: ... using Qiagen RNeasy Plus kit.200ng of extracted RNA was used to produce SARS-CoV-2 amplicon libraries using the NEBNext SARS-CoV-2 FS Library Prep Kit (Illumina) using the VarSkip Short Express Protocol with 25 minutes fragmentation step and 8 cycles of PCR enrichment ...
-
bioRxiv - Immunology 2020Quote: ... using NextSeq 500/550 v2.5 sequencing reagent kit (read length: 2 × 75 bp) or NovaSeq S1 sequencing reagent kit (read length: 2 × 100 bp) (Illumina) respectively ...
-
bioRxiv - Immunology 2020Quote: ... Sequencing was performed in a high-throughput MiSeq machine using either a v2 Nano reagent kit 2×250bp or a v3 reagent kit 2×300bp (Illumina) at the Genomic Research Unit (GRU ...
-
bioRxiv - Genomics 2020Quote: ... Pooled library sizes were selected (2% gel, BluePippin, Sage Science) and sent for 2 × 150-bp deep sequencing (Miseq, Illumina).
-
bioRxiv - Genomics 2021Quote: ... TrueSeq libraries were then sequenced as necessary for their desired length as paired end 2×151 and 2×301 read multiplex runs on MiSeq platform (Illumina) for pre-cursor and mature MAPT isoforms respectively ...
-
bioRxiv - Microbiology 2022Quote: ... and sequenced as 2 × 150 bp reads on the MiSeq sequencing instrument using the MiSeq Micro kit version 2 (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... the library was sequenced on an Illumina MiSeq with a MiSeq Reagent Kit v.2 (2 × 250 bp; Illumina Inc.). A total of 3.27 x 106 paired-end reads were obtained ...
-
bioRxiv - Microbiology 2022Quote: ... was combined with short-read whole-genome sequencing data for the 169 individuals (2×125 bp or 2×150 bp Illumina paired-end sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were sequenced on the Illumina NextSeq550 (2×75bp) (Plateforme Transcriptome, IRMB, Montpellier, France) or NovaSeq 6000 (2×75bp) (Illumina) at the CNAG ...
-
bioRxiv - Cell Biology 2020Quote: ... and 90 bases for Read 2 (Illumina 20012862). A PhiX control library was spiked in at 0.2 to 1% ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end 2×100 bp RNA-sequencing (Illumina TruSeq RNA Library Prep Kit ...
-
bioRxiv - Genomics 2021Quote: ... TruSeq Library Prep (Illumina, RS-122-2001/2), TruSeq Stranded Library Prep (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: ... using NextSeq500 2×75pb (Illumina NextSeq 500 platform) (Sup ...
-
bioRxiv - Cell Biology 2022Quote: ... Paired-end 2×100 bp RNA-sequencing (Illumina TruSeq RNA Library Prep Kit ...
-
bioRxiv - Microbiology 2021Quote: ... and sequencing (2 x 150 bp; Illumina HiSeq3000) at a 4-5 million reads per sample were performed by the Max Planck-Genome Center ...
-
bioRxiv - Genomics 2019Quote: ... read length of 2×150 bp (Illumina, USA). In total 183 samples were processed including a melanoma cohort (n= 168) ...
-
bioRxiv - Microbiology 2019Quote: ... paired end reads of 150nt x 2 (Illumina).