Labshake search
Citations for Illumina :
1 - 50 of 1992 citations for 5 Chloro 1 vinyl 2 pyridone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of Index primer (both provided in NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2), and 25 μl NEBNext Ultra II Q5 Master Mix (PCR cycling conditions ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were generated from 2-5 μg of genomic DNA using the TruSeq 2 library preparation kit (Illumina, USA). Two types of libraries were prepared ...
-
bioRxiv - Immunology 2020Quote: ... The enriched B cell libraries were sequenced in NextSeq or MiSeq sequencer using NextSeq Mid Output v2.5 sequencing reagent kit (read length: 2 × 150 bp) or MiSeq Reagent Kit v2 (read length: 2 × 150 bp) (Illumina) respectively.
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Genomics 2024Quote: ... Two libraries were pooled and sequenced on a NextSeq 550 using High Output Kit v2.5 (300 Cycles: 146 read 1, 18 index 1, 8 index 2, 146 read 2) (Illumina) according to the manufacturers protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... the NEBNext Ultra II DNA Library Preparation kit was used to generate libraries using 5-10 ng of input or immunoprecipitated DNA and barcode adaptors (NEBNext Multiplex Oligos for Illumina (Set 1, E7335 and Set 2, E7500)) ...
-
A New Gene Set Identifies Senescent Cells and Predicts Senescence-Associated Pathways Across TissuesbioRxiv - Cell Biology 2021Quote: ... and 2-5 cm inferior to the navel.24,38 Sequencing was performed on a HiSeq2000 (Illumina®), fastq files were mapped to the human reference genome hg19 ...
-
bioRxiv - Cancer Biology 2021Quote: ... on Thermo Fisher Scientific’s Quantstudio 5 before multiplex pooling and sequencing a 2×100 flow cell on the NovaSeq platform (Illumina) at the Collaborative Sequencing Center.
-
bioRxiv - Genomics 2021Quote: ... Lab 1 and 2 sequenced DNA with a NovaSeq 6000 (Illumina,
-
bioRxiv - Cell Biology 2024Quote: ... were pooled at a 1:1:1:etc ratio before sequencing on an Illumina NextSeq 500/550 instrument using a version 2 kit (Illumina). Fastq files were generated for each library in Illumina BaseSpace ...
-
bioRxiv - Genomics 2024Quote: ... A 2.5-kb ‘jumping’ library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced on an Illumina HiSeq 2000 ...
-
bioRxiv - Genetics 2024Quote: ... The libraries were amplified for 5 cycles and sequenced in 2×75-bp paired-end mode with NextSeq 500 sequencing technology (Illumina), per the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2022Quote: ... A 2.5 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced at the Broad Institute Genomics Platform on an Illumina HiSeq 2000 system to generate paired 101-base reads ...
-
bioRxiv - Cancer Biology 2020Quote: ... with MiSeq Reagent Kit V3 (150 cycle) (Illumina, MS-1-2-3001). The sequencing data was de-multiplexed and trimmed to contain only the sgRNA sequence cassettes ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Genomics 2023Quote: ... All libraries were pooled and subjected to paired-end 75 bp sequencing (paired- end 76 nt reads with the first 1 nt of Read 1 and the last 1 nt of Read 2 trimmed) using the NextSeq500 system (Illumina, CA, USA). For each library ...
-
bioRxiv - Genomics 2021Quote: ... Each batch was sequenced separately on 1-flowcell (2 lanes) HiSeq 2500 (Illumina) Rapid Mode platform with a single-end (1×50 bp ...
-
bioRxiv - Microbiology 2020Quote: ... Read 1 and 2 adapter recognition sequences were provided for adapter removal (Illumina TruSeq Adapter Read 1 ...
-
bioRxiv - Microbiology 2023Quote: ... gRNA abundances (read 1) and UMI barcodes (read 2) were quantified by Illumina sequencing and subsequently processed by the analysis described below.
-
bioRxiv - Cancer Biology 2024Quote: ... Purified PCR products were pooled 1:1 and a 5% PhiX DNA spike-in was included and sequenced by Illumina HiSeq PE150 platform at Novogene ...
-
bioRxiv - Microbiology 2023Quote: ... The quantified and denatured libraries were sequenced using paired-end 2×250-bp chemistry with 5% PhiX as an internal control on the Illumina MiSeq 2000 platform (Illumina Inc., USA). The quality-filtered reads were de-novo assembled using SPAdes (version 3.11.1) ...
-
bioRxiv - Systems Biology 2024Quote: ... 5’ amine-modified DNA oligonucleotides (5’-[AmC6]dUdUdUdUd-[Illumina_adaptor]-[spatial barcode]-[UMI]-[20T]-VN ...
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Cell Biology 2021Quote: ... using NextSeq 500 (2×75 bp) and HiSeq 4000 (1×50 bp) equipment (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... 2 × 1 μl (concentration of 10pmol/μl) MiSeq Nextera XT adapters (dual indexed, Illumina), and 6.5 μl of mQ water (Ultrapure) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... one RNA pool of 5 livers from each treatment and sex were independently subjected to sequencing (Illumina Novaseq 6000 paired-end (2×150)) ...
-
bioRxiv - Genomics 2022Quote: ... and DRB3, 4, 5 (exon 2) genes with Fluidigm Access Array (Fluidigm, Singapore) and sequenced on an Illumina MiSeq sequencer (Illumina, San Diego, USA). HLA alleles and genotypes are called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Microbiology 2020Quote: ... Read 1 and 2 adapter recognition sequences were provided for adapter removal (Illumina TruSeq Adapter Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCT TG, Illumina TruSeq Adapter Read 2 ...
-
bioRxiv - Microbiology 2021Quote: ... The purified PCR products were then processed and sequenced using the NextSeq 75 – High Output (82 cycles in read 1, 8 cycles in index 1, and 8 cycles in index 2 SE reads) (Illumina). The sequencing data was analyzed using the Model-Based Analysis of Genome-wide CRISPR/Cas9 Knockout (MAGeCK ...
-
bioRxiv - Neuroscience 2022Quote: ... using single end 75bp for Read 1 and 8bp for index 1 and 8bp for Index 2 with a high output 75bp kit (20024906, Illumina).
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina) were used for construction of complementary DNA libraries and the complementary DNA libraries were sequenced on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 (Illumina) and the HiSeq Rapid SBS Kit v2-HS (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 (Illumina) for the sequencing.
-
bioRxiv - Immunology 2023Quote: ... 2 (Illumina) was the primer source ...
-
bioRxiv - Genomics 2021Quote: ... and four mate-pair sequencing libraries (insert sizes of 2, 5, 10, and 15 kb) in accordance with manufacturer protocols (Illumina, San Diego, CA, USA). Libraries were then sequenced using a HiSeq2000 instrument (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... and diluted to 5 pM prior to sequencing on an Illumina MiSeq platform with a 2 × 250 bp paired-end protocol (Illumina, San Diego, CA, USA). Sequencing reads were deposited in the European Nucleotide Archive (ENA ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1–2 mg of total RNA was used for Ribo-Zero rRNA Removal kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5 μl of Nextera XT index primers 1 and 2 (Nextera XT Index kit, Illumina) and 2.5 μl of templated DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA fragments were then amplified by PCR using Nextera index primer 1 and 2 (Illumina) and produced by PCR amplification (10–13 cycles ...
-
bioRxiv - Genomics 2022Quote: ... We partitioned the genes into three categories: (1) >5-fold higher in Illumina (“Higher count in Illumina”); (2 ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Genomics 2024Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Neuroscience 2020Quote: ... Libraries generated with indexing version 2 (Supplementary Table 1) were sequenced on a HiSeq4000 (RRID:SCR_016386, Illumina) using custom sequencing primers with following read lengths ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.