Labshake search
Citations for Illumina :
51 - 100 of 2273 citations for 4 Methoxy 2 2 3 4 5 5 Hexacb 13C12 99% 50 Ug Ml In Toluene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... and ribosomal RNA was depleted from 5 ug of total RNA using the Ribo-Zero™ Gold Kit (Illumina, Inc.). Depleted mRNA was fragmented and converted to first strand cDNA ...
-
bioRxiv - Cancer Biology 2019Quote: ... 2 ug of RNA was used to prepare a cDNA library using TruSeq RNA Library Prep Kit v2 (Illumina). Sequencing was performed on an Illumina HiSeq 1500 System in a 1×50 bp single read mode ...
-
bioRxiv - Genomics 2019Quote: ... and three mate-pair libraries (insert sizes of 2 kb, 5 kb, and 8 kb) were constructed using the TruSeq PCR-free Kit (Illumina) and Mate-pair Kit (Illumina) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... The ~2 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina) as previously described [79] ...
-
bioRxiv - Microbiology 2022Quote: ... A 2.5 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced at the Broad Institute Genomics Platform on an Illumina HiSeq 2000 system to generate paired 101-base reads ...
-
bioRxiv - Genomics 2024Quote: ... A 2.5-kb ‘jumping’ library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced on an Illumina HiSeq 2000 ...
-
bioRxiv - Genetics 2024Quote: ... The libraries were amplified for 5 cycles and sequenced in 2×75-bp paired-end mode with NextSeq 500 sequencing technology (Illumina), per the manufacturer’s recommendations.
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end 2×50 bp sequencing performed using a HiSeq2500 system (Illumina). Data quality control performed using FastQC v0.11.8 ...
-
bioRxiv - Microbiology 2024Quote: ... Libraries were sequenced with 2×50 bp reads on a NextSeq2000 (Illumina). Demultiplexing ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 ug of total RNA were processed for rRNA depletion by Ribozero Gold rRNA Removal kit (Human/Mouse/Rat) (Illumina) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2023Quote: ... The prepared library was sequenced using a MiSeq sequencing system with a V3 reagent kit (300 × 2 bp; Illumina, 4–6 samples). Lake Biwa viral contigs/genomes (LBVs ...
-
FOXO dictate initiation of B cell development and myeloid restriction in common lymphoid progenitorsbioRxiv - Immunology 2022Quote: ... Libraries were sequenced paired-end (2×50 cycles) on the Illumina platform (Illumina). Reads were mapped using STAR (v 2.5.2b ...
-
FOXO dictate initiation of B cell development and myeloid restriction in common lymphoid progenitorsbioRxiv - Immunology 2022Quote: ... Libraries were sequenced paired-end (2×50 cycles) on the Illumina platform (Illumina). To obtain differential ATACseq peaks ...
-
bioRxiv - Genetics 2021Quote: ... and subjected to 2 × 50-bp paired-end sequencing on Hiseq XTen (Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were sequenced 2 * 50+8+16 bp on a HiSeq2500 sequencer (Illumina). RNA-seq data were processed according to Doyle et al ...
-
bioRxiv - Cancer Biology 2019Quote: ... Paired-end 2×50 bp sequencing was performed using a HiSeq2500 system (Illumina). Sequencing data are available through the NCBI Gene Expression Omnibus (GEO ...
-
bioRxiv - Genomics 2019Quote: ... Paired-end sequencing (2 × 50 nt) was performed on a HiSeq2500 system (Illumina).
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were sequenced pair-end (2×50 cycles) on the Illumina platform (Illumina). Reads were trimmed (using Trim Galore v0.4.1) ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA library preparation and sequencing (Illumina Novaseq SP, 2 × 50 bp read length). Differential expression was filtered by selecting transcripts with fold change ≥ |1.5| and a significance level of P ≤ 0.05 using PartekFlow.
-
bioRxiv - Genomics 2022Quote: ... spun at 300G for 12 min at 4 ºC and resuspended in 20 uL transposition mix: 1X TD buffer and 2 uL of TDE1 (Illumina #FC-121-1030), 0.01% Digitonin in DMSO ...
-
bioRxiv - Microbiology 2023Quote: ... The quantified and denatured libraries were sequenced using paired-end 2×250-bp chemistry with 5% PhiX as an internal control on the Illumina MiSeq 2000 platform (Illumina Inc., USA). The quality-filtered reads were de-novo assembled using SPAdes (version 3.11.1) ...
-
bioRxiv - Genomics 2020Quote: ... 64 RNA-Seq libraries (4 time points x 4 tissues x 4 biological replicates) were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). Libraries were sequenced on Illumina Nova-Seq 6000 sequencing platform at the Australian Genome Research Facility (AGRF ...
-
bioRxiv - Cell Biology 2021Quote: ... using NextSeq 500 (2×75 bp) and HiSeq 4000 (1×50 bp) equipment (Illumina).
-
bioRxiv - Cancer Biology 2020Quote: ... and 2×50 paired-end sequencing performed on NovaSeq S1 6000 flow cell (Illumina) flow to yield 100M reads per sample.
-
bioRxiv - Evolutionary Biology 2023Quote: ... The library was pooled with other samples at equimolar concentrations and sequenced at 4 nM as single lanes on Illumina NovaSeq 6000 S4 platform (2×150; Illumina Inc., San Diego, CA). The library for long-read data was prepared using the Nanopore ligation kit ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... one RNA pool of 5 livers from each treatment and sex were independently subjected to sequencing (Illumina Novaseq 6000 paired-end (2×150)) ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Plant Biology 2022Quote: ... We prepare 12 cDNA libraries (3 individuals □ 2 sampling times (dawn and dusk) □ 2 localities) using the TruSeq RNA-seq library prep kit from Illumina (Illumina, Inc., CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina) were used for construction of complementary DNA libraries and the complementary DNA libraries were sequenced on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 (Illumina) and the HiSeq Rapid SBS Kit v2-HS (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 (Illumina) for the sequencing.
-
bioRxiv - Immunology 2023Quote: ... 2 (Illumina) was the primer source ...
-
bioRxiv - Genomics 2021Quote: ... and four mate-pair sequencing libraries (insert sizes of 2, 5, 10, and 15 kb) in accordance with manufacturer protocols (Illumina, San Diego, CA, USA). Libraries were then sequenced using a HiSeq2000 instrument (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... and diluted to 5 pM prior to sequencing on an Illumina MiSeq platform with a 2 × 250 bp paired-end protocol (Illumina, San Diego, CA, USA). Sequencing reads were deposited in the European Nucleotide Archive (ENA ...
-
bioRxiv - Molecular Biology 2023Quote: ... Paired-end sequencing (2 x 50 nt) was performed on a NovaSeq 6000 system (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... The pellet was resuspended in 50 μl of transposition mixture (25 μl of 2× Illumina Tagment DNA buffer ...
-
bioRxiv - Genetics 2022Quote: ... the genome FASTA file was augmented with ERCC sequences to create a STAR genome index with 99 bp overhangs (optimized for Illumina 2 × 100 bp paired-end reads). Two-pass mapping was executed ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Approximately 5 ug of total RNAs were used to construct cDNA libraries (NEBNext Ultra Directional RNA Library Prep Kit for Illumina, Illumina, San Diego, CA, USA). Transcriptome sequencing was performed using the Illumina Hi-Seq 2000 platform ...
-
bioRxiv - Microbiology 2021Quote: ... 4) DC3000 + B (Illumina only), 5 ...
-
bioRxiv - Immunology 2021Quote: ... Group 4 (French European, Illumina), Group 5 (North American ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Molecular Biology 2022Quote: ... These libraries were sequenced in paired-end mode (2×50 cycles) with a Hiseq1500 sequencer (Illumina). Raw sequencing data were demultiplexed with Bcl2fastq (version 2.17.1.14 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and subjected to pair-end sequencing (100 cycles: 2×50) on the Novaseq-6000 sequencer (Illumina) at the Genomic platform (Gustave Roussy ...
-
bioRxiv - Systems Biology 2023Quote: They performed 2 × 50 bp paired-end sequencing on the NextSeq 2000 platform (Illumina Inc, #20038897) using NextSeq 1000/2000 P2 Reagents (100 cycles ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Molecular Biology 2022Quote: ... or purified chromosomes (2 x 106 pelleted at 10,000g for 10min at 4°C) were resuspended in 50 μl transposase mixture (25 μl Illumina TD buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each well contained 5□μL NIB and 5□μL TD buffer from Illumina, and 1 mL of 2.5 mM uniquely indexed transposome ...