Labshake search
Citations for Illumina :
1 - 50 of 632 citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... 8 pools of 24 randomized libraries were sequenced in 3 lanes at 100 bp single-end on the HiSeq 2500 (Illumina) using TruSeq SBS Kit v4 reagents (Illumina).
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Cell Biology 2022Quote: ... and Nextera™ DNA CD Indexes (24 Indexes, 24 Samples) (ref #20018707, Illumina) according to the manufacturer’s protocol (Nextera DNA Flex Library Document ...
-
bioRxiv - Systems Biology 2024Quote: ... was amplified using the primers SYM_VAR_5.8S2: 5′ (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG)GAATTGCAGAACTCCGTGAACC 3′ and SYM_VAR_REV: 5′ (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG)CGGGTTCWCTTGTYTGACTTCATGC 3′ (50) (Illumina adaptor overhangs underlined). For all samples ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the gRNAs using forward (5’-CGATACAAGGCTGTTAGAGAGATA-3’) and reverse (5’-GTTGCTATTATGTCTACTATTCTTTCCC-3’) primers and NEBNext HighFidelity 2X PCR Master Mix (Illumina). Library preparation was performed with the Nextera DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Evolutionary Biology 2022Quote: ... All the 24 ramets were sequenced by Illumina Hiseq ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Microbiology 2024Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR using universal bacterial primer sets (5’-TCGTCGG-CAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGG-TATCTAATCC-3’) and sequenced using the MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were processed using QIIME2 (version 2020.2 ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Genetics 2020Quote: ... and IV-5) individuals were genotyped using the Infinium Global Screening Array-24 v1.0 BeadChip (Illumina, SanDiego, CA, USA) according to manufacturer’s protocols ...
-
bioRxiv - Cell Biology 2020Quote: ... Single Nucleotide Polymorphism array Infinium Core-24 v1.1 Kit (Illumina) was used according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and 24 nuclei from each strain were sequenced by Illumina HiSeq-X at the SNP&SEQ Technology Platform in Uppsala at the National Genomics Infrastructure (NGI ...
-
bioRxiv - Molecular Biology 2022Quote: ... and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7), with both containing 8N barcodes for multiplexing.
-
bioRxiv - Cancer Biology 2022Quote: ... All of the 3′ and 5′ flowcells were demultiplexed with bcl2fastq (Illumina). FASTQ files were processed with Cell Ranger v7.0.1 (10x Genomics) ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Genetics 2021Quote: ... Amplified genomes were genotyped by Infinium® OmniExpress-24 v1.2 (Illumina, Inc.).
-
bioRxiv - Bioengineering 2021Quote: ... Molecular karyotype was performed using an Infinium Core-24 v1.2 Kit (Illumina) containing 300000 SNPs ...
-
bioRxiv - Genomics 2021Quote: ... Genotyping was then performed using the Infinium CoreExome-24 (v1.3) chip (Illumina).
-
bioRxiv - Immunology 2023Quote: Genotyping was performed on the Illumina Global Screening Array 24 v3 (Illumina). The vcf file exclusively containing chromosome 6 was used as an input for the Michigan Imputation Server Genotype Imputation HLA (Minimac4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Genotyping array was performed using Infinium Global Screening Array -24 v3.0 (Illumina) to evaluate genome integrity.
-
bioRxiv - Immunology 2024Quote: ... Genotyping was performed using the Infinium Global Screening Array-24 v3.0 (Illumina) by the Genome Centre ...
-
bioRxiv - Genetics 2024Quote: Genotyping was performed on the Illumina Global Screening Array 24 v3 (Illumina). For our sample QC ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Neuroscience 2022Quote: ... DNA samples were genotyped at Estonian Genome Center using Infinium PsychArray-24 v1.1 (Illumina). Quality control (QC ...
-
bioRxiv - Genomics 2020Quote: The 79 cell lines were genotyped by Infinium HumanCore-24 v1.1 BeadChip assay (Illumina). GenomeStudioTM V2.0 (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... using Infinium HumanOmniExpress-24-v1-1-a BeadChip technology (Illumina Inc. San Diego, CA), was performed at the Cancer Genomics Research Laboratory (CGR) ...
-
bioRxiv - Cell Biology 2023Quote: ... performed on 24 cells/cell line using a NextSeq 500 (Illumina, San Diego, CA). Data analysis was performed as described previously69 ...
-
bioRxiv - Genomics 2022Quote: ... DNA from each donor was genotyped on an Infinium HumanCore-24 v1.1 BeadChip (Illumina). GenomeStudioTM V2.0 (Illumina) ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... 16-24 million reads were obtained from each sample using a NovaSeq 6000 platform (Illumina). Reads were filtered with Trimmomatic (v0.36)(85) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The Illumina HumanCore-12 Custom BeadChip and HumanCore-24 Custom BeadChip (Illumina, San Diego, CA), were used for the genotyping ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Immunology 2022Quote: Samples were genotyped on the Infinium Global Screening Array (GSA)-24 v2.0 (Illumina, San Diego, CA), with 665,608 variants genotyped per sample ...
-
bioRxiv - Genomics 2021Quote: ... Subjects were genotyped using the Illumina Infinium Global Screening Array-24 v1.0 Beadchip (Illumina, California, U.S.) following standard protocols ...