Labshake search
Citations for Illumina :
1 - 50 of 836 citations for 3 Cyclohex 1 enyl acrylic acid methyl ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: Methyl-seq-captured libraries were sequenced using a Hiseq2500 device (Illumina), by applying paired-end 125bp reads ...
-
bioRxiv - Genomics 2021Quote: The TruSeq Methyl Capture Epic kit was a gift from Illumina. Sequencing libraries were prepared according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2024Quote: ... according to the Ovation RRBS Methyl-Seq System 1-16 protocol for the first read and the Read 2 primer (Illumina) for the second read ...
-
bioRxiv - Genetics 2023Quote: ... The Illumina TruSeq Methyl Capture EPIC library prep kit (Illumina, Santa Clara, CA, USA) was used following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... libraries were prepared using EpiGnome™ Methyl-Seq reagents (Illumina, Inc, San Diego, CA), index-tagged for multiplexing ...
-
bioRxiv - Genomics 2024Quote: TruSeq methyl capture libraries were prepared manually following the manufacture’s protocol (document 1000000001643 v01, Illumina). Briefly ...
-
bioRxiv - Genomics 2021Quote: ... All DNA methylation data was generated using the TruSeq Methyl Capture EPIC kit (FC-151-1003, Illumina) according to manufacturer’s protocol [62] ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 ng of ssDNA was used as input for the Epicenter EpiGnome™ Methyl-Seq Kit (Illumina, EGMK81312 ...
-
bioRxiv - Molecular Biology 2022Quote: Equimolar amounts of libraries for Enzymatic Methyl-seq were first sequenced on the iSeq 100 instrument (Illumina) using paired-end sequencing of 2x151 to assess both library and pooling qualities ...
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Genetics 2020Quote: ... Libraries were prepared with the Accel-NGS Methyl-Seq DNA Library Kit from Illumina (Cat No. 30096, Swift) and the sequencing was performed at Novogene (Hongkong ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Genetics 2020Quote: Whole genome bisulfite sequencing libraries were generated with the Accel-NGS Methyl-seq DNA Library Kit (Swift Biosciences) and sequenced on a HiSeq X10 (Illumina) in 150bp PE mode with PhiX spike-in to counteract low sequence diversity ...
-
bioRxiv - Cancer Biology 2022Quote: ... resistant and P12 cells of cell lines #3 and #9 was performed at the Genomics and Proteomics Core Facility of the German Cancer Research Center (GPCF DKFZ, Heidelberg) using the TruSeq DNA PCR-free Methyl protocol (Illumina) for library preparation ...
-
bioRxiv - Genomics 2024Quote: ... xGen Methyl-Seq Library kit was purchased from Integrated DNA Technologies and Nextera XT library prep kit was from Illumina, Inc.
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were cleaned using Sample Purification Beads from the TruSeq Methyl Capture EPIC LT Library Prep Kit (Illumina, #FC-151-1002) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Genomics 2022Quote: ... Whole genome bisulfite sequencing libraries were prepared (according to Accel-NGS Methyl-Seq DNA library Kit for Illumina protocol, Swift Biosciences) and sequenced in 150 bp paired-end reads by Novogene company.
-
bioRxiv - Cancer Biology 2022Quote: ... Post-ligation cleanup proceeded according to Illumina’s instructions with 110 µL Sample Purification Mix from the TruSeq Methyl Capture EPIC LT Library Prep Kit (Illumina catalog # FC-151-1002). After purification ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Genomics 2020Quote: ... sequencing libraries were prepared from 1 ng gDNA using the Nextera XT Library Preparation Kit v.3 (Illumina) and sequenced on the Illumina NextSeq system (paired end 2 x 150 bp insert size) ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Molecular Biology 2024Quote: ... CUT&RUN libraries (10–20 Mio reads per sample and 1/3 of reads for the controls) were sequenced on a NovaSeq 6000 (Illumina) paired end 100 bp at the Deep Sequencing Facility (Max Planck Institute for Immunobiology and Epigenetics ...
-
bioRxiv - Developmental Biology 2024Quote: ... Amplification was carried out using 3 µl of NMP per sample and adding 1 µl of each dual-indexed (i7 and i5; Illumina) primer ...
-
bioRxiv - Immunology 2023Quote: ... ADT and 3’ Gexp libraries were mixed at the ratio of 1:5 and sequenced on NovaSeq 6000 sequencer (Illumina) with a configuration of 28/8/0/91-bp for cell barcode ...
-
bioRxiv - Systems Biology 2024Quote: ... was amplified using the primers SYM_VAR_5.8S2: 5′ (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG)GAATTGCAGAACTCCGTGAACC 3′ and SYM_VAR_REV: 5′ (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG)CGGGTTCWCTTGTYTGACTTCATGC 3′ (50) (Illumina adaptor overhangs underlined). For all samples ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: ... and an independent validation set (3 Illumina HumanMethylation450K array studies ...
-
bioRxiv - Genomics 2024Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the gRNAs using forward (5’-CGATACAAGGCTGTTAGAGAGATA-3’) and reverse (5’-GTTGCTATTATGTCTACTATTCTTTCCC-3’) primers and NEBNext HighFidelity 2X PCR Master Mix (Illumina). Library preparation was performed with the Nextera DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...