Labshake search
Citations for Illumina :
1 - 50 of 323 citations for 3 Chloro phenyl 9H fluoren 9 ylmethoxycarbonylamino acetic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 9) DC3000 − C (Illumina only), 10 ...
-
bioRxiv - Cancer Biology 2022Quote: ... performed the library preparation for WGS of parental and resistant cells of cell lines #3 and #9 as well as a control tail samples corresponding to line #3 with the TruSeq DNA PCR-free Kit (Illumina) and the 150 bp paired-end sequencing on a HiSeq X (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... water (n=9) and sediment (n=9) samples were subjected to bacterial 16S rRNA amplicon profiling by Illumina sequencing ...
-
bioRxiv - Genetics 2023Quote: ... to 9 uL of FSA (Illumina #20020599). After cDNA synthesis ...
-
bioRxiv - Microbiology 2021Quote: ... the pooled library was diluted to 9 pM and spiked with 15% of 9-pM PhiX prepared from PhiX Control Kit v3 (Illumina). The pooled library was then loaded on the MiSeq sequencer (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... 9-cycle PCR were performed using indexed primers from Nextera Index Kit (Illumina) and KAPA HiFi HotStart ReadyMix (KAPA Biosystems) ...
-
bioRxiv - Physiology 2024Quote: ... RNA with RIN > 9 were single-end sequenced on a HiSeq4000 platform (Illumina) with a minimum of 8 M reads per sample at a 50 nt read length ...
-
bioRxiv - Developmental Biology 2021Quote: ... a 9-cycle PCR was performed using indexed primers from Nextera Index Kit (Illumina) and KAPA HiFi HotStart ReadyMix (KAPA Biosystems) ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Developmental Biology 2021Quote: ... Samples with RNA Integrity numbers >9 were Ribosomal RNA depleted using RiboZero Gold Kit (Illumina). Libraries were prepared using an RNA Sample Prep V2 Kit (Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples of sufficient quality (RIN>9) were subjected to library preparation (Illumina Truseq mRNA kit) followed by sequencing using Illumina Novaseq 6000 (single read ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Immunology 2021Quote: ... Permeabilized cells were brought up to a volume of 9 μl in TD1 buffer (Illumina, 15027866) and mixed with 6 μl of Illumina TDE1 Tn5 transposase (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... Samples with high integrity (RIN score>9) were selected for PolyA-enrichment and TruSeq library preparation (Illumina). Each sample was sequenced to a target depth of 37.5 million read pairs using a NovaSeq 6000 device (Illumina).
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RNA integrity > 9) were selected for library preparation using the Illumina Stranded mRNA Prep Ligation protocol (Illumina, USA), following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Neuroscience 2020Quote: ... Libraries were prepared from 9 biological replicates of each condition using the Truseq Stranded mRNA Library Prep Kit (Illumina #20020594) following manufacturer’s instructions and sequenced using the HiSeq-2500 sequencing platform (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... The 9 genomic DNA pools for sequencing were prepared by mixing equimolar concentrations of DNA from which 9 libraries were prepared with an insert size of 350 bp using a TruSeq PCR-free sample prep kit (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples with RNA integrity number (RIN) > 9 were used for sequencing library construction with the TruSeq Stranded mRNA sample preparation protocol (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... sequences (9 Go for cell lines and 15 Go for acinar cells) were generated using a NovaSeq 6000 apparatus (Illumina) by Novogen (Cambridge ...
-
bioRxiv - Microbiology 2023Quote: ... and colonising (clinical non-CAPA) (C402, C404-C407, C409, C410) isolates from the Netherlands (n=9) were sequenced using NextSeq 550 sequencer (Illumina), and 218 UK and Irish isolates and the five IA isolates (C307 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified multiplex libraries were diluted to 9 nM concentration (calculated based on Qubit dsDNA HS Assay Kit) and sequenced on a NovaSeq 6000 instrument (Illumina) from IntegraGen SA ...
-
bioRxiv - Genomics 2023Quote: ... Three RNA extractions passing QC (RIN > 9) were pooled in equimolar concentrations and a single transcriptomic library was constructed using Truseq mRNA kit (Illumina) and sequenced on a Illumina Novaseq 6000 sequencer (200M reads ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Systems Biology 2024Quote: ... was amplified using the primers SYM_VAR_5.8S2: 5′ (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG)GAATTGCAGAACTCCGTGAACC 3′ and SYM_VAR_REV: 5′ (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG)CGGGTTCWCTTGTYTGACTTCATGC 3′ (50) (Illumina adaptor overhangs underlined). For all samples ...
-
bioRxiv - Genomics 2020Quote: ... sequencing reads were mapped to reference viral genome sequence and consensus sequence for each sample was built using Dragen RNA pathogen detection software (version 9) in BaseSpace (Illumina Inc, USA). For amplified whole-genome sequencing ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNAs from WT and e2fabc at 9 DAG were used for construction of cDNA libraries using the TruSeq RNA Library Preparation Kit v2 (Illumina, United States) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: ... and an independent validation set (3 Illumina HumanMethylation450K array studies ...
-
bioRxiv - Genomics 2024Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Neuroscience 2021Quote: ... with 5 ng input RNA followed by 9 cycles of PCR amplification and library preparation using the Nextera XT DNA Library Prep Kit (Illumina, San Diego, CA). Sequencing was performed on a NovaSeq 6000 (Illumina) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sequencing libraries were prepared according to the TruSeq stranded total library preparation kit with RiboZero Gold treatment (Illumina, Inc., Cat No.20020598/9). Paired-reads (150 bp ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples with an RNA integrity number of > 9 were used for construction of a complementary DNA library by an Illumina TruSeq kit (Illumina, San Diego, CA). The sequencing strategy was 100 bp paired-end by an Illumina HiSeq 4000 ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the gRNAs using forward (5’-CGATACAAGGCTGTTAGAGAGATA-3’) and reverse (5’-GTTGCTATTATGTCTACTATTCTTTCCC-3’) primers and NEBNext HighFidelity 2X PCR Master Mix (Illumina). Library preparation was performed with the Nextera DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...