Labshake search
Citations for Illumina :
1 - 50 of 1540 citations for 3 2 Bromophenyl 9 phenyl 9H carbazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
bioRxiv - Microbiology 2021Quote: ... 9) DC3000 − C (Illumina only), 10 ...
-
bioRxiv - Cancer Biology 2022Quote: ... performed the library preparation for WGS of parental and resistant cells of cell lines #3 and #9 as well as a control tail samples corresponding to line #3 with the TruSeq DNA PCR-free Kit (Illumina) and the 150 bp paired-end sequencing on a HiSeq X (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Microbiology 2020Quote: ... water (n=9) and sediment (n=9) samples were subjected to bacterial 16S rRNA amplicon profiling by Illumina sequencing ...
-
bioRxiv - Genetics 2023Quote: ... to 9 uL of FSA (Illumina #20020599). After cDNA synthesis ...
-
bioRxiv - Microbiology 2021Quote: ... the pooled library was diluted to 9 pM and spiked with 15% of 9-pM PhiX prepared from PhiX Control Kit v3 (Illumina). The pooled library was then loaded on the MiSeq sequencer (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Plant Biology 2022Quote: ... We prepare 12 cDNA libraries (3 individuals □ 2 sampling times (dawn and dusk) □ 2 localities) using the TruSeq RNA-seq library prep kit from Illumina (Illumina, Inc., CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... RNA with RIN > 9 were single-end sequenced on a HiSeq4000 platform (Illumina) with a minimum of 8 M reads per sample at a 50 nt read length ...
-
bioRxiv - Neuroscience 2022Quote: ... 9-cycle PCR were performed using indexed primers from Nextera Index Kit (Illumina) and KAPA HiFi HotStart ReadyMix (KAPA Biosystems) ...
-
bioRxiv - Cell Biology 2024Quote: ... After 2-3 passages in complete DMEM with 10% FBS gDNA was extracted to confirm the genotype by Illumina amplicon sequencing and live cell microscopy was performed.
-
bioRxiv - Developmental Biology 2021Quote: ... a 9-cycle PCR was performed using indexed primers from Nextera Index Kit (Illumina) and KAPA HiFi HotStart ReadyMix (KAPA Biosystems) ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were constructed with version 2 (stage 16a) or version 3 (stage15 a/b) chemistry and sequenced on a single HiSeqX (Illumina) lane to generate 400-450 million paired-end 150 bp reads (Supplementary Table 4).
-
bioRxiv - Microbiology 2020Quote: ... The obtained partitions were further processed using the Chromium Single Cell 3’ Reagent Kit (version 2, 10x Genomics) to generate Nextera XT sequencing libraries that were sequenced on a HiSeq3000 (Illumina), using a single flow cell lane for each library.
-
bioRxiv - Developmental Biology 2021Quote: ... Samples with RNA Integrity numbers >9 were Ribosomal RNA depleted using RiboZero Gold Kit (Illumina). Libraries were prepared using an RNA Sample Prep V2 Kit (Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples of sufficient quality (RIN>9) were subjected to library preparation (Illumina Truseq mRNA kit) followed by sequencing using Illumina Novaseq 6000 (single read ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Genomics 2024Quote: ... we further pooled the hybrid selection into 3 “super pools.” 2) The hybrid selected libraries were sequenced on a NovaSeq 6000 (Illumina, 20012850) with a S1 Reagent Kit v1.5 (200 cycles ...
-
bioRxiv - Immunology 2021Quote: ... Permeabilized cells were brought up to a volume of 9 μl in TD1 buffer (Illumina, 15027866) and mixed with 6 μl of Illumina TDE1 Tn5 transposase (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... Samples with high integrity (RIN score>9) were selected for PolyA-enrichment and TruSeq library preparation (Illumina). Each sample was sequenced to a target depth of 37.5 million read pairs using a NovaSeq 6000 device (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... Goe13 and lysogens and sequenced with the MiSeq system and reagent kit V.3 (2 x 300 bp) (Illumina, San Diego, CA, USA) and the NovaSeq system (2x 150bp ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Cancer Biology 2023Quote: ... and RNA integrity > 9) were selected for library preparation using the Illumina Stranded mRNA Prep Ligation protocol (Illumina, USA), following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Neuroscience 2020Quote: ... Libraries were prepared from 9 biological replicates of each condition using the Truseq Stranded mRNA Library Prep Kit (Illumina #20020594) following manufacturer’s instructions and sequenced using the HiSeq-2500 sequencing platform (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... The 9 genomic DNA pools for sequencing were prepared by mixing equimolar concentrations of DNA from which 9 libraries were prepared with an insert size of 350 bp using a TruSeq PCR-free sample prep kit (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples with RNA integrity number (RIN) > 9 were used for sequencing library construction with the TruSeq Stranded mRNA sample preparation protocol (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... sequences (9 Go for cell lines and 15 Go for acinar cells) were generated using a NovaSeq 6000 apparatus (Illumina) by Novogen (Cambridge ...
-
bioRxiv - Genomics 2023Quote: ... Three RNA extractions passing QC (RIN > 9) were pooled in equimolar concentrations and a single transcriptomic library was constructed using Truseq mRNA kit (Illumina) and sequenced on a Illumina Novaseq 6000 sequencer (200M reads ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified multiplex libraries were diluted to 9 nM concentration (calculated based on Qubit dsDNA HS Assay Kit) and sequenced on a NovaSeq 6000 instrument (Illumina) from IntegraGen SA ...
-
bioRxiv - Microbiology 2023Quote: ... and colonising (clinical non-CAPA) (C402, C404-C407, C409, C410) isolates from the Netherlands (n=9) were sequenced using NextSeq 550 sequencer (Illumina), and 218 UK and Irish isolates and the five IA isolates (C307 ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina) were used for construction of complementary DNA libraries and the complementary DNA libraries were sequenced on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 (Illumina) and the HiSeq Rapid SBS Kit v2-HS (Illumina ...