Labshake search
Citations for Illumina :
1 - 50 of 864 citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Systems Biology 2024Quote: ... was amplified using the primers SYM_VAR_5.8S2: 5′ (TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG)GAATTGCAGAACTCCGTGAACC 3′ and SYM_VAR_REV: 5′ (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG)CGGGTTCWCTTGTYTGACTTCATGC 3′ (50) (Illumina adaptor overhangs underlined). For all samples ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the gRNAs using forward (5’-CGATACAAGGCTGTTAGAGAGATA-3’) and reverse (5’-GTTGCTATTATGTCTACTATTCTTTCCC-3’) primers and NEBNext HighFidelity 2X PCR Master Mix (Illumina). Library preparation was performed with the Nextera DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Microbiology 2024Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR using universal bacterial primer sets (5’-TCGTCGG-CAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGG-TATCTAATCC-3’) and sequenced using the MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were processed using QIIME2 (version 2020.2 ...
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7), with both containing 8N barcodes for multiplexing.
-
bioRxiv - Cancer Biology 2022Quote: ... All of the 3′ and 5′ flowcells were demultiplexed with bcl2fastq (Illumina). FASTQ files were processed with Cell Ranger v7.0.1 (10x Genomics) ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Microbiology 2023Quote: ... as well as 6 PCR negative control and 3 extraction negatives on a NovaSeq 6000 (Illumina), with 2 Gb requested per sample.
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Genomics 2021Quote: ... and (3) 134 Gb (~100× depth) chromosome conformation capture sequencing (Hi-C) data (sequenced by Illumina platform).
-
bioRxiv - Genomics 2020Quote: ... 64 RNA-Seq libraries (4 time points x 4 tissues x 4 biological replicates) were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). Libraries were sequenced on Illumina Nova-Seq 6000 sequencing platform at the Australian Genome Research Facility (AGRF ...
-
bioRxiv - Immunology 2021Quote: ... DRB3/4/5 kits) for sample library preparations and ran on a Miseq sequencer (Illumina), following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Molecular Biology 2020Quote: ... Nuclei were then pelleted (1,000xg, 10min, 4°C) and transposed in 2.5µl Tn5 (Nextera Tn5 transposase, Illumina), 12.5µl TD reaction buffer and 10.5µl water for 40min at 37°C with rotation ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Microbiology 2021Quote: ... 4) DC3000 + B (Illumina only), 5 ...
-
bioRxiv - Immunology 2021Quote: ... Group 4 (French European, Illumina), Group 5 (North American ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4 µL Nextera (Illumina). The reaction was stopped with 1% SDS and incubated at 72C for 10 minutes ...
-
bioRxiv - Bioengineering 2021Quote: ... Additional adapters at 5’-end (P5 and SP1) and 3’-end (P7 and SP2) were designed by Illumina for sequencing purpose ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: ... and an independent validation set (3 Illumina HumanMethylation450K array studies ...
-
bioRxiv - Genomics 2024Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Genomics 2021Quote: ... Nuclear isolation of 5×10^4 cells was followed by treatment with Nextera Tn5 enzyme (Illumina, 20034198) for 45 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).