Labshake search
Citations for Illumina :
1 - 50 of 1985 citations for 2 4 Difluoro N 2 methoxy 5 4 4 morpholinyl 6 quinazolinyl 3 pyridinyl benzenesulfonamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Microbiology 2023Quote: ... The prepared library was sequenced using a MiSeq sequencing system with a V3 reagent kit (300 × 2 bp; Illumina, 4–6 samples). Lake Biwa viral contigs/genomes (LBVs ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Physiology 2020Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample ...
-
bioRxiv - Genomics 2022Quote: ... and DRB3, 4, 5 (exon 2) genes with Fluidigm Access Array (Fluidigm, Singapore) and sequenced on an Illumina MiSeq sequencer (Illumina, San Diego, USA). HLA alleles and genotypes are called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Small RNA-seq libraries for 2–4 biological samples were sequenced together using a NextSeq 500 (Illumina) to obtain 75 nt ...
-
bioRxiv - Genomics 2020Quote: ... 64 RNA-Seq libraries (4 time points x 4 tissues x 4 biological replicates) were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). Libraries were sequenced on Illumina Nova-Seq 6000 sequencing platform at the Australian Genome Research Facility (AGRF ...
-
bioRxiv - Microbiology 2021Quote: ... 4) DC3000 + B (Illumina only), 5 ...
-
bioRxiv - Immunology 2021Quote: ... Group 4 (French European, Illumina), Group 5 (North American ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4 µL Nextera (Illumina). The reaction was stopped with 1% SDS and incubated at 72C for 10 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were sequenced using 2 x 150 nt paired-end sequencing runs (4 lanes on separate runs) on NextSeq Genome Sequencer (Illumina) with a NextSeq 500/550 High Output Kit v2.5 at Core Facility for Scientific Research – University of Sao Paulo (CEFAP-USP).
-
bioRxiv - Genomics 2023Quote: ... all samples were pooled at 4 nm concentration and paired-end [300bp (2 × 151bp)] sequenced in MiSeq platform (Illumina, USA).
-
bioRxiv - Genomics 2020Quote: ... Each pool (2nM per library; Agilent SureSelect XT HS, n=6; Agilent SureSelect XT RNA Direct, n=6; Illumina TruSeq RNA Exome, n=5) was sequenced on one lane on the Illumina HiSeq 3000 platform in the Technology Center for Genomics and Bioinformatics at UCLA ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Systems Biology 2021Quote: ... Libraries were then pooled in groups of 4 and sequenced on 4 lanes on a NextSeq500 sequencer (Illumina) using 10X Genomics recommended reads configuration.
-
bioRxiv - Immunology 2021Quote: ... DRB3/4/5 kits) for sample library preparations and ran on a Miseq sequencer (Illumina), following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Immunology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Microbiology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Genomics 2022Quote: ... spun at 300G for 12 min at 4 ºC and resuspended in 20 uL transposition mix: 1X TD buffer and 2 uL of TDE1 (Illumina #FC-121-1030), 0.01% Digitonin in DMSO ...
-
bioRxiv - Genomics 2020Quote: ... The normalised samples (4 nM) were denatured with 0.2 N NaOH and diluted 20 pM using pre-chilled Hybridisation Buffer (HT1) (Illumina, USA). The 20 pM transcriptome libraries were further diluted to 10 pM with pre-chilled HT1 buffer prior to whole transcriptome sequencing on a MiSeq platform.
-
bioRxiv - Microbiology 2021Quote: ... UK). Libraries were prepared from 8 samples (4× T. brucei, 4× T. congolense) using the TruSeq Stranded mRNA kit (Illumina) and 2 × 75 bp paired-end sequencing was carried out using a HiSeq 4000 system (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Barcoded libraries of ten samples (4 treated, 4 untreated and two controls) were equimolarly pooled and sequenced on MiSeq (Illumina) using MiSeq v3 150 reagent kit (MS-102-3001 ...
-
bioRxiv - Genomics 2023Quote: ... coverage and eight additional female genomes (4 Asian and 4 African) at ~30× (1 lane of Illumina Hiseq X Ten) coverage using 10x Linked-Reads at HudsonAlpha Institute of Biotechnology ...
-
bioRxiv - Genomics 2023Quote: ... 4 washes with PR2 buffer (PR2, Illumina MiSeq), and 6 minute incubation at 60°C with shaking followed by 4 washes was performed a total of 3 times ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The library was pooled with other samples at equimolar concentrations and sequenced at 4 nM as single lanes on Illumina NovaSeq 6000 S4 platform (2×150; Illumina Inc., San Diego, CA). The library for long-read data was prepared using the Nanopore ligation kit ...
-
bioRxiv - Genomics 2021Quote: ... Nuclear isolation of 5×10^4 cells was followed by treatment with Nextera Tn5 enzyme (Illumina, 20034198) for 45 minutes at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Immunology 2022Quote: ... or NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Systems Biology 2023Quote: ... 200-500 ng DNA was used for genotyping using the Infinium Omni2.5-8v1-4 and the Infinium Omni2.5-8v1-5 Genotyping BeadChip (Illumina) at the UCSD IGM core ...
-
bioRxiv - Microbiology 2024Quote: ... version 3 (2×300 bp read length; Illumina), following to the manufacturer’s instruction.
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Genetics 2022Quote: ... Nuclei pellet was obtained by centrifugation at 500g for 5 minutes at 4 degrees and resuspended in 100μl ice-cold 1x TD buffer (20034198, Illumina). About 10K nuclei was used for transposition reaction at 37 degrees for 30 minutes in a thermomixer ...
-
bioRxiv - Cancer Biology 2020Quote: ... and loaded at 4 nM into the MiSeq sequencer (Illumina) v3 chemistry kit spiked with 10% PhiX genome ...
-
bioRxiv - Immunology 2023Quote: ... or the NovaSeq XP 4-Lane Kit v1.5 (Illumina, 20043131).
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95 % endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95% endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Genomics 2022Quote: ... The library was run across 4 lanes of a NovaSeq (Illumina), multiplexed with other samples.
-
bioRxiv - Molecular Biology 2022Quote: ... by adding 4 μl of 1× CircLigase II Buffer (Epicentre/Illumina), 2 μl of 50mM of MnCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... puteoserpentis (499ROV/1-4) specimens using short-read (Illumina HiSeq 3000) and long-read (PacBio ...
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA depletion with additional probes recommended by Illumina (Table 4), stranded library preparation (Illumina Ribo-Zero Plus rRNA Depletion w/ Stranded Total RNA) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and NovaSeq 1.5 Xp 4-Lane Kit (Illumina, cat. no. 20043131), samples were sequenced on the NovaSeq 6000 system (Illumina).
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were sequenced (4 samples per Illumina Novaseq SP flow cell) aiming for a minimum 25,000 read pairs per spot ...
-
bioRxiv - Genomics 2022Quote: ... pH 7.4, 5 mM MgCl2, 10% dimethyl formamide, 0.33x PBS, 0.01% digitonin, 0.1% Tween-20, 100 nM Illumina Tn5 Transposase (Illumina, 20034197)) ...