Labshake search
Citations for Illumina :
1 - 50 of 8936 citations for 2'3' cyclic GAMP cGAMP ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... the nuclei flash-frozen in the tube strips were thawed on ice and 13.7 μl of transposition buffer (which contains 12.5 μl of 2X Illumina Tagment DNA Buffer ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Primer Cocktail (Nextera DNA Sample Preparation Kit and Nextera Index Kit, Illumina). Amplification was performed in a Veriti 96 Well Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Immunology 2021Quote: ... 150 µl from the 14 pM pool was loaded into each well of an 8-well strip tube and loaded onto a cBot (Illumina) for cluster generation ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 100 μl from the 16 pM pool were loaded into each well of an 8-well strip tube and placed onto a cBot (Illumina) for cluster generation ...
-
bioRxiv - Immunology 2023Quote: ... 150µL from the 14pM pool was loaded into each well of an 8-well strip tube and loaded onto a cBot (Illumina) for cluster generation ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5’ Illumina adapter (used in the Illumina small RNA kit) and a T7 promoter) ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 µL of transposase enzyme (Illumina Tagment DNA TDE1 kit, 20034197). We also included additional components ...
-
bioRxiv - Molecular Biology 2019Quote: ... the 5’ Illumina adapter (as used in the Illumina small RNA kit), a 3 nt UMI (unique molecular identifier) ...
-
bioRxiv - Molecular Biology 2019Quote: ... the 5’ Illumina adapter (as used in the Illumina small RNA kit) and a T7 promoter ...
-
bioRxiv - Cell Biology 2022Quote: ... 8 plates of mRNA libraries were sequenced using the Nextseq550 high output kit (Illumina) with 35 paired-end reads according to the manufacturer’s recommendations ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Immunology 2019Quote: ... 0.01% digitonin and 5 μl of Tn5 from the Nextera kit from Illumina, Cat ...
-
bioRxiv - Immunology 2021Quote: ... 0.01% digitonin and 5 μl of Tn5 from the Nextera kit from Illumina, Cat ...
-
bioRxiv - Genomics 2023Quote: ... the 5’ Illumina adapter (as used in the Illumina TruSeq Small RNA kit) and a split 2x 3 nt Unique Molecular Identifier (UMI ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genomics 2023Quote: A 96-well plate pre-loaded with 5 μl of 500 nM pre-indexed Tn5 transposase per well (iTSM plate, kind gift of Illumina Inc.) was used to multiplex samples and perform barcoded transposition ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Immunology 2020Quote: ... The enriched B cell libraries were sequenced in NextSeq or MiSeq sequencer using NextSeq Mid Output v2.5 sequencing reagent kit (read length: 2 × 150 bp) or MiSeq Reagent Kit v2 (read length: 2 × 150 bp) (Illumina) respectively.
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µg of total cellular RNA was depleted of ribosomal RNA (RiboZero kit, Illumina), and subjected to base hydrolysis ...
-
bioRxiv - Genetics 2021Quote: ... A receptacle 96 well plate was prepared with 9uL 1X TD buffer (Nextera XT Kit, Illumina Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... this new plate was used for library preparation (Nextera XT kit; Illumina, Cat#: FC-131–1096) using a semi-automated pipeline ...
-
bioRxiv - Immunology 2021Quote: ... DRB3/4/5 kits) for sample library preparations and ran on a Miseq sequencer (Illumina), following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Genomics 2020Quote: ... The harvested single-cell cDNA was barcoded in 96 well plate using Nextera XT Library Prep kit (Illumina). Uniquely barcoded libraries from single-cells pooled together and sequenced using a HiSeq-Hi-output-2500 sequencer (Illumina) ...
-
bioRxiv - Immunology 2021Quote: ... along with number of cells loaded onto each plate was optimized for S1 and S2 100 cycle kits (Illumina) with the configuration of 67×8×50 bp ...
-
bioRxiv - Immunology 2020Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A-D (Illumina). Finally ...
-
bioRxiv - Immunology 2022Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A–D (Illumina). Finally ...
-
bioRxiv - Immunology 2022Quote: ... up to four plates were barcoded at a time with Nextera XT Index Kit v2 Sets A–D (Illumina). Dual-barcoded libraries were pooled and sequenced using Illumina Nextseq 550 platform ...
-
bioRxiv - Cell Biology 2021Quote: ... The purified DNA was PCR amplified for 5 cycles using a Nextera DNA Library Index kit (Illumina) and Phusion HF Master Mix (New England BioLabs ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was harvested and diluted to 0.1–0.3 ng/μl and libraries were prepared in 96-well plates using a Nextera XT DNA Sample Preparation kit (Illumina) according to the protocol supplied by Fluidigm ...
-
bioRxiv - Microbiology 2022Quote: ... Sequencing libraries were prepared using the Nextera XT DNA library preparation kit and combinations of IDT index plates (Illumina, USA). The final libraries were cleaned through AMPure SPRI bead (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were quantified using the KAPPA quantification kit following manufacturers protocol after which the plates were sequenced on the NextSeq 500 (Illumina) for 30 million reads per plate.
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were quantified using the KAPPA quantification kit following manufacturers protocol after which the plates were sequenced on the NextSeq 500 (Illumina) for 25 million reads per plate.
-
bioRxiv - Molecular Biology 2023Quote: Libraries were then prepared for deep sequencing using the Nextera XT DNA Library Prep kit in a 96-well plate format (Illumina). Manufacturer’s instructions were followed for each step ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was tagmented in 5 technical replicates of 1 ng cDNA each using the Nextera XT Kit (Illumina), according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and 5’-end RNA-seq library preparation using tagmentation-based modified Nextera XT DNA sample Preparation kit (Illumina). Libraries were tagged with a plate-specific i7 index and were pooled for sequencing on an Illumina NextSeq2000 platform ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5’-end RNA-seq library preparation using tagmentation-based modified Nextera XT DNA sample Preparation kit (Illumina). Libraries were tagged with a plate-specific i7 index and were pooled by batches of 4-9 plates for sequencing on an Illumina NextSeq550 platform ...
-
bioRxiv - Microbiology 2021Quote: ... 5 ng of DNA was used as input to create Illumina sequencing libraries using the Nextera kit (Illumina). The samples were pooled and sequenced on an Illumina NextSeq 500 High Output system to obtain 2×150 bp reads ...
-
bioRxiv - Plant Biology 2020Quote: ... custom adapters for selecting 5’-P mRNAs and primers from the TruSeq Small RNA Sample Preparation Kit (Illumina) for multiplexing the libraries as indicated in Zhai et al (2014) ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Tagment DNA Enzyme and 20 μl nuclease free water (Nextera DNA Sample Preparation Kit, Illumina, UK) for 45 min at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Amplicon libraries were mixed with 5% PhiX and sequenced with four MiSeq reagent kits v2 500 cycles (Illumina). A blank extraction kit control ...
-
bioRxiv - Cancer Biology 2019Quote: ... the Midi plate from Illumina’s Rapid Capture Exome kit was replaced with a skirted PCR plate to facilitate automation ...
-
bioRxiv - Cancer Biology 2019Quote: ... the Midi plate from Illumina’s Nextera Exome Kit was replaced with a skirted PCR plate to facilitate automation ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were generated from 2-5 μg of genomic DNA using the TruSeq 2 library preparation kit (Illumina, USA). Two types of libraries were prepared ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing libraries were prepared according to the TruSeq stranded mRNA library preparation kit (Illumina, Inc., Cat No.20020594/5) including poly-A selection ...
-
bioRxiv - Systems Biology 2021Quote: ... 5 µg fragmented RNA was used for ribosomal RNA removal using Ribo-Zero Gold rRNA Removal Kit (MRZG12324 Illumina) according to Illumina’s protocol for TruSeq Ribo Profile Kit (RPHMR12126 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dual indexed sequencing libraries were made out of 5 ng cDNA from the above preparations using Illumina Nextera library preparation kit according to manufacturer’s instructions (Illumina). Quality checked and equimolar pooled libraries were sequenced in a HiSeq 4000 Illumina system ...
-
bioRxiv - Cell Biology 2020Quote: ... rRNA was depleted from 5 μg of total RNA using the Ribo-Zero Gold Yeast rRNA Removal Kit (Illumina) according to the manufacturer’s protocol ...