Labshake search
Citations for Illumina :
1 - 50 of 2107 citations for 1 5 Bis 2 2 methyl 1 oxoallyl oxy ethyl dihydrogen benzene 1 2 4 5 tetracarboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... Two libraries were pooled and sequenced on a NextSeq 550 using High Output Kit v2.5 (300 Cycles: 146 read 1, 18 index 1, 8 index 2, 146 read 2) (Illumina) according to the manufacturers protocol ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of Index primer (both provided in NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2), and 25 μl NEBNext Ultra II Q5 Master Mix (PCR cycling conditions ...
-
bioRxiv - Microbiology 2023Quote: ... for each sample 2 μl of 5’ adapter (Illumina) (total 12 μl ...
-
bioRxiv - Microbiology 2021Quote: ... 5 in treatment d28_0 and 5 from d28_100 (Illumina HiSeq, 2×150bp, GenoScreen, France). Reads corresponding to animal sequences were identified by aligning each dataset against Oryzias latipes available at the NCBI ...
-
bioRxiv - Systems Biology 2024Quote: ... according to the Ovation RRBS Methyl-Seq System 1-16 protocol for the first read and the Read 2 primer (Illumina) for the second read ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were generated from 2-5 μg of genomic DNA using the TruSeq 2 library preparation kit (Illumina, USA). Two types of libraries were prepared ...
-
bioRxiv - Immunology 2020Quote: ... The enriched B cell libraries were sequenced in NextSeq or MiSeq sequencer using NextSeq Mid Output v2.5 sequencing reagent kit (read length: 2 × 150 bp) or MiSeq Reagent Kit v2 (read length: 2 × 150 bp) (Illumina) respectively.
-
bioRxiv - Genomics 2021Quote: ... Lab 1 and 2 sequenced DNA with a NovaSeq 6000 (Illumina,
-
bioRxiv - Cell Biology 2024Quote: ... were pooled at a 1:1:1:etc ratio before sequencing on an Illumina NextSeq 500/550 instrument using a version 2 kit (Illumina). Fastq files were generated for each library in Illumina BaseSpace ...
-
bioRxiv - Cancer Biology 2020Quote: ... with MiSeq Reagent Kit V3 (150 cycle) (Illumina, MS-1-2-3001). The sequencing data was de-multiplexed and trimmed to contain only the sgRNA sequence cassettes ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Genomics 2023Quote: ... All libraries were pooled and subjected to paired-end 75 bp sequencing (paired- end 76 nt reads with the first 1 nt of Read 1 and the last 1 nt of Read 2 trimmed) using the NextSeq500 system (Illumina, CA, USA). For each library ...
-
bioRxiv - Genomics 2021Quote: ... Each batch was sequenced separately on 1-flowcell (2 lanes) HiSeq 2500 (Illumina) Rapid Mode platform with a single-end (1×50 bp ...
-
bioRxiv - Microbiology 2020Quote: ... Read 1 and 2 adapter recognition sequences were provided for adapter removal (Illumina TruSeq Adapter Read 1 ...
-
bioRxiv - Microbiology 2023Quote: ... gRNA abundances (read 1) and UMI barcodes (read 2) were quantified by Illumina sequencing and subsequently processed by the analysis described below.
-
bioRxiv - Molecular Biology 2020Quote: ... the NEBNext Ultra II DNA Library Preparation kit was used to generate libraries using 5-10 ng of input or immunoprecipitated DNA and barcode adaptors (NEBNext Multiplex Oligos for Illumina (Set 1, E7335 and Set 2, E7500)) ...
-
bioRxiv - Genomics 2022Quote: ... and DRB3, 4, 5 (exon 2) genes with Fluidigm Access Array (Fluidigm, Singapore) and sequenced on an Illumina MiSeq sequencer (Illumina, San Diego, USA). HLA alleles and genotypes are called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Cell Biology 2021Quote: ... using NextSeq 500 (2×75 bp) and HiSeq 4000 (1×50 bp) equipment (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... 2 × 1 μl (concentration of 10pmol/μl) MiSeq Nextera XT adapters (dual indexed, Illumina), and 6.5 μl of mQ water (Ultrapure) ...
-
bioRxiv - Microbiology 2020Quote: ... Read 1 and 2 adapter recognition sequences were provided for adapter removal (Illumina TruSeq Adapter Read 1: AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCT TG, Illumina TruSeq Adapter Read 2 ...
-
bioRxiv - Microbiology 2021Quote: ... The purified PCR products were then processed and sequenced using the NextSeq 75 – High Output (82 cycles in read 1, 8 cycles in index 1, and 8 cycles in index 2 SE reads) (Illumina). The sequencing data was analyzed using the Model-Based Analysis of Genome-wide CRISPR/Cas9 Knockout (MAGeCK ...
-
bioRxiv - Neuroscience 2022Quote: ... using single end 75bp for Read 1 and 8bp for index 1 and 8bp for Index 2 with a high output 75bp kit (20024906, Illumina).
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina) were used for construction of complementary DNA libraries and the complementary DNA libraries were sequenced on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 (Illumina) and the HiSeq Rapid SBS Kit v2-HS (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 (Illumina) for the sequencing.
-
bioRxiv - Immunology 2023Quote: ... 2 (Illumina) was the primer source ...
-
bioRxiv - Cancer Biology 2020Quote: ... 1–2 mg of total RNA was used for Ribo-Zero rRNA Removal kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 2.5 μl of Nextera XT index primers 1 and 2 (Nextera XT Index kit, Illumina) and 2.5 μl of templated DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... DNA fragments were then amplified by PCR using Nextera index primer 1 and 2 (Illumina) and produced by PCR amplification (10–13 cycles ...
-
A New Gene Set Identifies Senescent Cells and Predicts Senescence-Associated Pathways Across TissuesbioRxiv - Cell Biology 2021Quote: ... and 2-5 cm inferior to the navel.24,38 Sequencing was performed on a HiSeq2000 (Illumina®), fastq files were mapped to the human reference genome hg19 ...
-
bioRxiv - Neuroscience 2020Quote: ... Libraries generated with indexing version 2 (Supplementary Table 1) were sequenced on a HiSeq4000 (RRID:SCR_016386, Illumina) using custom sequencing primers with following read lengths ...
-
bioRxiv - Microbiology 2021Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Cell Biology 2022Quote: ... version 2 (Illumina) using 10 PCR cycles ...
-
bioRxiv - Microbiology 2022Quote: ... diluted at a ratio of 1:2 and amplified following the Nextera XT Index protocol (Illumina, Inc.). The amplicons were normalized using a SequalPrep™ Normalization Plate Kit (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Cancer Biology 2021Quote: ... on Thermo Fisher Scientific’s Quantstudio 5 before multiplex pooling and sequencing a 2×100 flow cell on the NovaSeq platform (Illumina) at the Collaborative Sequencing Center.
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Genomics 2020Quote: ... 300×2 bp or 150×2 bp (Illumina, Inc., San Diego, CA).
-
bioRxiv - Molecular Biology 2023Quote: ... A 2 µl aliquot of the denatured library pool is then added to 1 ml of HT1 (Illumina), mixed and 120 µl is added to the ‘sample library’ cBot strip tube ...
-
bioRxiv - Genomics 2024Quote: ... A 2.5-kb ‘jumping’ library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced on an Illumina HiSeq 2000 ...
-
bioRxiv - Genetics 2024Quote: ... The libraries were amplified for 5 cycles and sequenced in 2×75-bp paired-end mode with NextSeq 500 sequencing technology (Illumina), per the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2022Quote: ... A 2.5 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced at the Broad Institute Genomics Platform on an Illumina HiSeq 2000 system to generate paired 101-base reads ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina, CA, USA). The two types of libraries ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl transposase (Illumina), 10.5 μl nuclease-free water and 0.01% NP-40 ...
-
bioRxiv - Immunology 2021Quote: ... Group 2 (France, Illumina), Group 3 (North America ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 from Illumina libraries.
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, CA, USA). ASVs were inferred using DADA2 v ...
-
bioRxiv - Cancer Biology 2021Quote: ... adding Illumina sequencing adapters and dual-index barcodes (index 1(i7) and index 2(i5)) (Illumina, San Diego, CA) to the amplicon target ...
-
bioRxiv - Immunology 2023Quote: ... The samples were sequenced in a paired-end run (read 1: 28bp, read 2: 91bp) on a NovaSeq6000 platform using S1 v1.5 (100 cycles) sequencing kits (Illumina). Bcl2fastq software (v2.20.0.422 ...