Labshake search
Citations for Illumina :
4701 - 4750 of 9681 citations for ssc mir 299 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... DNA was tagmented using Nextera XT DNA library preparation kit (FC-131-1096, Illumina, USA) and dual-indexed with Nextera XT Index Kit V2 Sets A-D (FC-131-2001 ...
-
bioRxiv - Cell Biology 2023Quote: ... and RNA-seq was performed using the Miseq Reagent Kit V2 (MS-102-2001, Illumina).
-
bioRxiv - Genetics 2023Quote: ATAC-seq was performed using the Nextera DNA Library Prep Kit (Illumina FC-121-1030). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... and sequencing libraries were constructed with NEBNext UltraII Directional RNA Library Preparation Kit (Illumina, #E7760) as described previously [65] ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cDNA libraries were generated using the Illumina TruSeq Stranded mRNA Sample Prep Kit (Illumina). Samples were sequenced on the Illumina HiSeq2500 platform as 150-bp single-end reads ...
-
bioRxiv - Immunology 2023Quote: ... Libraries were prepared using an Illumina Stranded mRNA Library Prep kit (Illumina, Cat no. 20040534) with IDT for Illumina RNA Unique Dual Index adapters following the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2023Quote: ... using the Illumina NextSeq 500/550 High Output Kit v2.5 (75 cycles) (Cat. #20024906, Illumina). Target depth was 5 – 10 million reads per sample.
-
bioRxiv - Bioengineering 2023Quote: ... All sequencing was performed using an Illumina NextSeq 75 cycle high-output kit (Illumina 20024906) in a paired end format (38 cycles read 1 + 37 cycles read 2) ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA-seq libraries were prepared using the Illumina TruSeq Stranded mRNA Library Prep Kit (Illumina) according to manufacturer instructions and sequenced on a HiSeq 2500 platform (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified DNA was used for library preparation using the NEBNext Ultra Library prep Kit (Illumina) according to manufacturer’s instructions with the following Epicypher manufacturer’s modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... and converted to cDNA (NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina). cDNA from each sample was amplified and barcoded in a mild stringency PCR (20 cycles of 30 seconds at 98°C ...
-
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNAbioRxiv - Molecular Biology 2023Quote: ... RNA libraries were prepared using a TruSeq Stranded Total RNA Library Prep Gold kit (Illumina). RNA library quality was assessed using a 2200 TapeStation with a D1000 ScreenTape system (Agilent) ...
-
bioRxiv - Microbiology 2023Quote: ... one nanogram of DNA was fragmented and adapter ligated using the Nextera XT kit (Illumina) and unique 8bp dual-index adapters (IDT ...
-
bioRxiv - Microbiology 2023Quote: ... Next-generation sequencing libraries were prepared with a Nextera XT kit (Illumina, San Diego, CA), and libraries were sequenced on an Illumina MiSeq using 300-bp paired-end reads ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Immunology 2023Quote: ... an Illumina library was prepared using a Nextera DNA Library Preparation Kit (Illumina, SanDiego, CA) according to SMARTer kit instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced on an Illumina MiSeq using the MiSeq Reagent kit v3 (Illumina, 600 cycles). Individual amplicon pools were extracted from the raw sequencing data using the FASTQ workflow in BaseSpace (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA library was prepared using TruSeq RNA Library Prep Kit v2 (Illumina, RS-122-2001). The sequencing library was quantified and verified using Qubit dsDNA High Sensitivity Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA-Seq libraries were prepared using the TruSeq Stranded mRNA Library Prep kit (Illumina, 2002059). RNA-Seq and ChIP-Seq libraries were quantified on a Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stranded libraries were prepared using a TruSeq Stranded Total RNA Library Prep Gold kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and tagmented using the enzyme and buffer provided in the Nextera Library Prep Kit (Illumina). Tagmented DNA was purified using the MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and quantified using qPCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824) as previously described (Couturier et al ...
-
bioRxiv - Plant Biology 2023Quote: ... Libraries were constructed by Macrogen using the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina). Libraries were sequenced on an Illumina NovaSeq6000 platform NovaSeq6000 via paired-end sequencing of 150bp reads ...
-
bioRxiv - Biophysics 2023Quote: ... using iSeq 100 i1 reagent v2 kit (300 cycle) 2 x 150 read length (Illumina). The total number of reads were 150,000-400,000 per sample ...
-
bioRxiv - Microbiology 2023Quote: ... 16S rRNA gene sequencing was performed using the Illumina MiSeq Reagent Kit v2 by Illumina MiSeq System (Illumina ...
-
bioRxiv - Systems Biology 2023Quote: ... Strand-specific sequencing libraries were constructed using the TruSeq Stranded Total RNA Prep kit (Illumina). DNA sequencings were performed at the NHLBI DNA Sequencing and Genomics Core ...
-
bioRxiv - Microbiology 2023Quote: ... and submitted final products to library preparation (NEBNext Ultra RNA Library Prep Kit for Illumina), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... using the TruSeq Stranded Total RNA Library Prep Gold Kit (Illumina, San Diego, CA, USA), and for sequencing on the HiSeq4000 platform (Illumina) ...
-
bioRxiv - Immunology 2023Quote: ... RNA-seq libraries were prepared using a Nextera XT kit (Illumina, San Diego, California, USA). Further ...
-
bioRxiv - Biochemistry 2023Quote: RNA was used to prepare cDNA libraries with a Truseq sRNA library prep kit (Illumina), following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: The RNA Seq library was generated using Illumina Tru-Seq stranded mRNA kit (Illumina 20020594) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... The RNA libraries were created using the TrueSeq Small RNA Library preparation kit from Illumina, and then sequenced for 45 cycles on the Illumina HiSeq 2000 platform (1 x 75bp read length) ...
-
bioRxiv - Biochemistry 2023Quote: ... RNA-sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep Kit (Illumina). Paired-end 150bp sequencing was done on a NovaSeq 6000 machine (Illumina).
-
bioRxiv - Genomics 2023Quote: ... Sequencing was conducted on a NovaSeq 6000 with a 300 cycle Reagent kit v1.5 (Illumina) to produce 150 bp paired-end ...
-
bioRxiv - Bioengineering 2023Quote: ... Nextera XT Index Kits (96 indexes, 384 samples) were purchased from Illumina (FC-131-1002). Axygen AxyPrep Mag PCR Clean-up Kits were purchased from Thermo Fisher Scientific (MAGPCRCL) ...
-
bioRxiv - Genetics 2023Quote: ... DNA was extracted from whole blood using MasterPure DNA Purification Kit (Biozym, Illumina Inc, USA). DNA quality and quantity estimation was done by agarose gel electrophoresis and spectrophotometry ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei pellets resuspended in 50μl of Nextera DNA Sample Preparation Kit (Illumina FC-121-1030) for tagmentation ...
-
bioRxiv - Molecular Biology 2023Quote: We used the TruSeq small RNA library prep sequencing kit (Illumina, San Diego, CA, USA) for library preparation according to manufacturing instructions except for the changes listed below ...
-
bioRxiv - Cancer Biology 2023Quote: RNA-Seq libraries for Illumina sequencing were prepared using TruSeq stranded mRNA kit (Illumina, 20020595) according to manufacturer’s instructions for high-throughput sample workflow ...
-
bioRxiv - Cancer Biology 2023Quote: ... sequencing was performed using the HiSeq 3000/4000 SBS Kit (50 cycles, Illumina, SanDiego, USA) on an Illumina HiSeq 3000/4000 (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA-seq libraries were prepared with the TruSeq stranded total RNA library prep kit (Illumina). single-end sequencing (75 bp ...
-
bioRxiv - Genomics 2023Quote: Sequencing libraries were prepared using the Nextera FLEX kit and Nextera Unique Dual Indexes (Illumina). Pooled libraries were sequenced on a NovaSeq 6000 (Illumina).
-
bioRxiv - Genetics 2023Quote: ... Libraries were prepared using Nextera XT DNA library preparation kits (Illumina, Inc., San Diego, CA) following the manufacturers protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... and sequenced (100 bp paired-end reads) using a TruSeq 200 cycle SBS kit (Illumina). Samples were run on an Illumina HiSeq2000 sequencer (tissue specimens ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA libraries were prepared with Illumina TruSeq RNA sample preparation kits (RS-122-2002, Illumina). RNA integrity was assessed using an Agilent 2100 Bioanalyzer (cutoff value of RIN 8 or higher ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were constructed following the manufacturer’s protocol (NEBNext UltraTMII DNA Library Prep Kit for Illumina). For each sample ...
-
bioRxiv - Microbiology 2022Quote: ... Libraries were sequenced on the MiSeq Reagent Kit v2 (300 cycles) (Illumina MS-102-2002) using the following read structure ...
-
bioRxiv - Genomics 2023Quote: ... Ribosomal RNA was removed with the RiboZero-Gold rRNA removal Kit (Illumina, cat. No MRZG12324). Ribosome protected fragments were size selected from a 15% denaturing urea polyacrylamide gel (PAGE ...
-
bioRxiv - Genomics 2023Quote: ... Sequencing was performed using the Miniseq® High Output Kit (Illumina®, San Diego, USA) generating paired-end reads of 150 bp ...
-
bioRxiv - Genomics 2023Quote: ... and used for standard poly(A)+ selection and library preparation with the TruSeq kit (Illumina). Following sequencing to at least 20 million reads on a NovaSeq platform (Illumina) ...