Labshake search
Citations for Illumina :
401 - 450 of 2538 citations for Trisodium dichloroanthra 2 1 9 mna naphth 2 3 h acridine 5 10 15 triyl tris sulfate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... Paired end 2×151 bp reads were produced using the HiSeq 4000 platform (Illumina). An average of 149 million read pairs were obtained per Seraseq sample (range of 86M to 227M read pairs).
-
bioRxiv - Genomics 2021Quote: ... 2 μg of DNA-free total RNA was ribodepleted using Ribo-Zero Gold (Illumina) according to the manufacturer protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... Paired-end sequencing (2 × 75 bp reads) was performed with NextSeq 500 (Illumina, USA). Reads were aligned to the zebrafish genome assembly GRCz10 using STAR v2.7.7a [61] and samtools v1.11 [62] ...
-
bioRxiv - Genomics 2021Quote: ... Paired end libraries were sequenced using 2 × 300 bp 3rd generation reagent kits (Illumina). Short read data was assembled using the de novo assembly algorithm ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA-sequencing libraries were prepared using the TruSeq RNA Sample Preparation 2 Kit (Illumina). The library quality was checked using an Agilent 2100 Bioanalyzer and concentration was measured by a Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The libraries were sequenced in 2 × 150 nt manner on HiSeq Xten platform (Illumina).
-
bioRxiv - Evolutionary Biology 2021Quote: ... The libraries were sequenced in 2 × 150 nt manner on HiSeq Xten platform (Illumina).
-
bioRxiv - Evolutionary Biology 2021Quote: ... The libraries were sequenced in 2 × 150 nt manner on HiSeq Xten platform (Illumina).
-
bioRxiv - Cancer Biology 2020Quote: ... and 2×50 paired-end sequencing performed on NovaSeq S1 6000 flow cell (Illumina) flow to yield 100M reads per sample.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Samples were paired-end sequenced (2×300 bp) on a MiSeq platform (Illumina, USA) using the MiSeq Reagent kit v3 (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... Demultiplexing and adapter clipping was done using the bcl2fastq(2) conversion software (Illumina, USA).
-
bioRxiv - Evolutionary Biology 2021Quote: ... sample 2 was treated with 20 U RNase R (Epicentre/Illumina, Cat. No. RNR07250) for 1 h at 37°C to degrade linear RNAs ...
-
bioRxiv - Microbiology 2023Quote: ... The libraries were sequenced (2 × 150 base pairs (bp)) on a MiniSeq System (Illumina). Sequencing reads were aligned with the reference sequences and SHAPE-MaP reactivity profiles for each position was calculated using ‘Shapemapper-2.15’37 with default parameter ...
-
bioRxiv - Immunology 2023Quote: ... and paired end-sequenced on the NovaSeq 6000 (Illumina, read length 2 x 101bp). Adaptor sequences and polyT tails were trimmed from unprocessed reads with fqtrim (v 0.9.7 ...
-
bioRxiv - Pathology 2023Quote: ... Final pool was sequenced using the 2×151 bp P1 reagent (20050264, Illumina, USA) and NextSeq2000 sequencer ...
-
bioRxiv - Microbiology 2023Quote: ... (California, USA) for library prep and 2×150bp sequencing on a NovaSeq6000 (Illumina, USA). The run resulted in 21Gb of data with 140,278,770 raw reads ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced using HiSeq 2000 sequencing with 2 × 150 bp paired-end chemistry (Illumina). On average ...
-
bioRxiv - Immunology 2022Quote: Individually indexed libraries were sequenced using the MiSeq V3 2 × 300 cycle system (Illumina). The R1 and R2 reads were processed using the IgDiscover (TCR version) ...
-
bioRxiv - Physiology 2022Quote: ... Libraries were pooled and sequenced paired-ended for 2×75 cycles (Nextseq500 sequencer, Illumina). 30-40 million fragments were generated per sample and quality controls were performed ...
-
bioRxiv - Microbiology 2024Quote: ... using the Illumina MiSeq platform with a read length of 2 × 150 bp (Illumina). A subset of 100,000 reads was sampled for each phage ...
-
bioRxiv - Microbiology 2024Quote: ... 2 μl of each P5 and P7 primer (Nextera Index Kit, Illumina, CA, USA), 2 μl of initial PCR product ...
-
bioRxiv - Neuroscience 2024Quote: ... using 2 NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Two Nextseq runs were performed to compile enough reads (19-32 million pass-filter reads).
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... Libraries were subsequently sequenced on a NovaSeq S2 Flowcell (paired end 2×56bp) (Illumina). All samples in this study were prepared and sequenced at the same time ...
-
bioRxiv - Plant Biology 2023Quote: ... Paired-end reads (2 x 150 bp) were on a HiSeq 3000 instrument (Illumina). Sequencing reads were first quality trimmed and filtered with Trimmomatic (version 0.36 ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced with 2×150 bp paired-end reads on a NovaSeq platform (Illumina).
-
bioRxiv - Biochemistry 2022Quote: ... or NextSeq with 2 × 151 paired-end reads and v2 or v2.5 chemistry (Illumina), and aligned to the hg38 genomic assembly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing (2 x 100 bp) was carried out with HiSeq 4000 (Illumina), pooling two patients’ samples on one lane ...
-
bioRxiv - Genomics 2022Quote: ... scherzeri were sequenced with 2×150 bp chemistry on the Illumina MiSeq platform (Illumina), respectively ...
-
bioRxiv - Immunology 2022Quote: ... barcoding and sequencing using HiSeq configured for 2×150 bp paired-end reads (Illumina). An average of 28.9 × 106 paired reads was generated per sample with a mean quality score of 35.81 ...
-
bioRxiv - Plant Biology 2022Quote: ... Paired-end reads (2 × 150 bp) were generation on the HiSeq 3000 platform (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... whole SARS-CoV-2 genome cDNA libraries were generated using a MiniSeq system (Illumina) with a MiniSeq mid-output kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... libraries were sequenced 2 x 150 paired end using a NovaSeq 6000 instrument (Illumina) to get 30x coverage on the genome ...
-
bioRxiv - Microbiology 2023Quote: ... Transposon mutant 19_H4 was sent for whole genome sequencing (Illumina; 2 X 151 bp) to identify the insertion site of the transposon.
-
bioRxiv - Bioengineering 2023Quote: ... Libraries were then sequenced on NextSeq 500 Mid Output with 2×150 bp (Illumina). The Cell Ranger VDJ pipeline was used for sample de-multiplexing and barcode processing.
-
bioRxiv - Developmental Biology 2024Quote: ... The resulting sequencing library were performed pair-end sequenced (2 x 150bp) by Illumina NovaSeq instruments at Novogene Bioinformatics Institute ...
-
bioRxiv - Genetics 2024Quote: ... These pooled libraries underwent 2 × 250 bp sequencing (Illumina HiSeq 2500, Psomagen, Rockville, MD).
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of isolated genomic DNA sample and 100 nmol of each primer (WISH_Illumina_fwd and WISH_Illumina_rev ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µl of isolated genomic DNA sample and 100 nmol of each primer (WISH_Illumina_fwd and WISH_Illumina_rev ...
-
bioRxiv - Neuroscience 2024Quote: ... and pooled equimolar to 2 nM for single-read sequencing on the HiSeq4000 (Illumina) with settings 51-8-8 ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 × 150 nucleotides paired-end sequencing on a HiSeq4000 platform (Illumina Inc., USA) were carried out as communicated previously (Bhattacharya et al ...
-
bioRxiv - Microbiology 2024Quote: ... and passed to paired-end sequencing (2 × 150 bp) on a NovaSeq6000 platform (Illumina). On average ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were paired-end sequenced (2 x 300 bp) on a MiSeq (Illumina) using a MiSeq Reagent kit v3 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... Paired-end sequencing (2 × 149 bp) was performed on a NextSeq 550 system (Illumina) using high-output flow cells ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were paired-end sequenced (2×300 bp) on a MiSeq (Illumina, USA) using a MiSeq Reagent kit v3 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... and paired-end sequencing (2 × 300 bp) was conducted via Illumina MiSeq (Illumina, USA) at the Institute of Clinical Molecular Biology (IKMB ...
-
bioRxiv - Cancer Biology 2024Quote: ... The pellet was incubated in the transposase reaction mix (25µL 2×TD buffer (Illumina), 2.5µL transposase (Illumina Cat# FC-121-1030 ...
-
bioRxiv - Physiology 2024Quote: ... RNA with RIN > 9 were single-end sequenced on a HiSeq4000 platform (Illumina) with a minimum of 8 M reads per sample at a 50 nt read length ...
-
bioRxiv - Neuroscience 2022Quote: ... 9-cycle PCR were performed using indexed primers from Nextera Index Kit (Illumina) and KAPA HiFi HotStart ReadyMix (KAPA Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...