Labshake search
Citations for Illumina :
401 - 450 of 1023 citations for Recombinant Human CD40 protein Fc tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Libraries were prepared following the instructions of the TruSeq DNA Sample Preparation Kit (Illumina, #FC-121-2001) and sequenced on the HiSeq 2500 and the Nextseq 500 (Illumina).
-
bioRxiv - Immunology 2021Quote: ... RNA-seq libraries were generated with the Nextera XT DNA Library Preparation kit (FC-131-1024, Illumina) and manufacturer’s protocol ...
-
bioRxiv - Genetics 2020Quote: ... and 22.5 μl nuclease-free water) (Nextera DNA Library Prep Kit (Illumina, cat. no. FC-121-1030). The transposase reaction was performed at 37°C for 30 minutes ...
-
bioRxiv - Immunology 2021Quote: The Illumina-specific adapters were added using the Illumina TruSeq Library Preparation Kit (Illumina, FC-121-3001) according to the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: Library preparation was performed using the Illumina Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). Libraries in each batch were multiplexed together so that every sequencing lane contained three samples ...
-
bioRxiv - Genetics 2020Quote: Illumina sequencing libraries were prepared using Nextera XT DNA Library Prep Kit (Illumina, cat# FC-131-1096). The concentrations of cDNA libraries were diluted to 0.1-0.3ng/ul ...
-
bioRxiv - Developmental Biology 2022Quote: ... using the NextSeq® 500/550 High Output Kits v2.5 (50 cycles; Cat# FC-404-2005, Illumina). The sequencing outputs were processed using the CellRanger software v3.1.0 on the Massachusetts Green High Performance Computer Cluster (GHPCC) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Tagmentation and amplification was performed using Nextera XT DNA Library Preparation Kit (Illumina, cat #FC-131-1096) and 600 pg input of each sample ...
-
bioRxiv - Immunology 2022Quote: ... RNAseq libraries were prepared with the Nextera XT DNA Library Preparation Kit (cat# FC-131–1096, Illumina) and carrying out 8 PCR cycles ...
-
bioRxiv - Microbiology 2022Quote: ... We then used an adaptation of the Nextera Library Prep kit (Illumina, cat. FC-121-1030/1031) (73 ...
-
bioRxiv - Microbiology 2022Quote: ... The library was prepared using Nextera XT DNA Library Preparation kit (Lot No. FC-131-1096, Illumina) and sequencing was performed on an Illumina Novoseq 6000 platform.
-
bioRxiv - Neuroscience 2023Quote: ... Pellets were resuspended in transposase reaction mix (25 μL 2x TD Buffer (Illumina Cat #FC-121-1030) 2.5 μL Tn5 Transposase (Illumina Cat #FC-121-1030 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Add (batch-determined actitivty) 2 to 2.5 uL of Nextera Tn5 transposase (Cat# FC-121-1030, Illumina. Samples were incubated at 37C for 30 minutes in a thermomixer at 500 RPM shaking ...
-
bioRxiv - Neuroscience 2022Quote: ... and then sequenced Paired-End 101 bases using the HiSeq SBS Kit v4 (Illumina, FC-401-4003) on a HiSeq 2500 system ...
-
bioRxiv - Molecular Biology 2023Quote: ... with 25 μl of 2x TD buffer and 2.5 μl tagmentation enzyme (Illumina transposase FC-121-1030). DNA was purified using a Qiagen mini elute kit following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... The quantified library pool was diluted to 1 nM and sequenced on MiniSeq (Illumina, FC-420-1001) to check for the quality of reads ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The pellets were resuspended in the reaction buffer (25 μL TD Buffer (Illumina Cat #FC-121-1030), 2.5 μL Tn5 Transposes (Illumina Cat #FC-121-1030) ...
-
bioRxiv - Microbiology 2023Quote: ... which was performed using the Nextera XT library preparation kit (Illumina, FC-131-1096, San Diego, California) and then subsequent sequencing on the NovaSeq 6000 platform (1 x 100bp ...
-
bioRxiv - Developmental Biology 2023Quote: ... Library DNAs were prepared according to the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096) and sequenced by Illumina NextSeq 500 (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... The nuclei were resuspended in transposition reaction mix (2x TD Buffer (Illumina Cat #FC-121–1030, Nextera), 2.5 µl Tn5 Transposase (Illumina ...
-
bioRxiv - Bioengineering 2023Quote: ... The library was prepared using Nextera XT DNA library preparation kit (Illumina, cat no. FC-131-1096). For each setting ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclei were resuspended in 50 µl transposition reaction mix with Nextera Tn5 Transposase (Illumina, FC-121-1030) and incubated for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the pellet of nuclei was subjected to transposition with Nextera Tn5 transposase (Illumina #FC-121–1030) for 30 min at 37°C ...
-
bioRxiv - Cancer Biology 2019Quote: DNA methylation data (Illumina human methylation 450k BeadChip) and clinical information of 8,118 patients across 24 tissue types were obtained from in GDC data portal [29] using TCGAbiolink (Bioconductor package ...
-
bioRxiv - Neuroscience 2022Quote: ... Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina; NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350 ...
-
bioRxiv - Microbiology 2023Quote: ... ‘human/mouse’ and ‘bacteria’ Ribo-Zero kits (Illumina). RNA quality and concentration were verified by BioAnalyzer (Agilent Technologies ...
-
bioRxiv - Genetics 2024Quote: The Infinium Human Methylation EPIC BeadChip (Illumina, USA) array was performed according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Methylation data (Illumina Human Methylation 450 platform) for TCGA cohorts were downloaded from the Firebrowse website hosed by Broad Institute of MIT and Harvard ...
-
bioRxiv - Immunology 2021Quote: ... Separately labeled cDNA libraries were multiplexed according to the manufacturer’s protocol (Illumina, San Diego CA). The libraries were sequenced on an Illumina NextSeq500 sequencer using a paired end sequencing run set as ...
-
bioRxiv - Neuroscience 2019Quote: ... 750 ng of the labeled cRNA was hybridized to MouseRef-8 v2 expression beadchips (Illumina) for 16 h before washing and analyzing according to the manufacturer’s directions ...
-
bioRxiv - Genomics 2020Quote: ... Two μg of genomic DNA from each organism was subjected to indexed-tagged pair-end sequencing on an Illumina Hiseq 2000 platform (Illumina, CA, USA) to generate 100 bp paired-end reads ...
-
bioRxiv - Microbiology 2022Quote: ... Each sample’s total DNA was fragmented and tagged with sequencing adapters using Nextera XT DNA Library Preparation Kit (Illumina, San Diego, CA). As previously described ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were pooled and sequenced on the Illumina NextSeq 500/550 High Output platform (Illumina, FC-404-2002) up to 18 samples per lane with 1% PhiX spike as a control.
-
bioRxiv - Genomics 2020Quote: ATAC-seq was performed as previously described using the Nextera DNA Library Prep Kit (Illumina #FC-121-1030). First ...
-
bioRxiv - Genomics 2019Quote: ... Nuclei were then transposed for 30’ at 37’C with adapter-loaded Nextera Tn5 (Illumina, Fc-121-1030). Transposed fragments were directly PCR amplified and sequenced on an Illumina NextSeq 500 to generate 2x 75bp paired-end reads.
-
bioRxiv - Evolutionary Biology 2020Quote: ... from 1 μg DNA using the TruSeq PCRfree DNA sample preparation kit (FC-121-3001/3002, Illumina Inc.) targeting an insert size of 350 bp as directed ...
-
bioRxiv - Neuroscience 2019Quote: ATAC-seq libraries were prepared using the Tn5 transposase system (Nextera DNA library kit, Illumina, FC-121–1030) as previously described (23) ...
-
bioRxiv - Bioengineering 2021Quote: ... 570 μL of denatured library DNA and 30 μL of denatured PhiX control library (Illumina, FC-110-3001) were mixed ...
-
bioRxiv - Cell Biology 2021Quote: ... Nuclei were then transposed for 30 min at 37C with adaptor-loaded Nextera Tn5 (Illumina, Fc-121-1030). Transposed fragments were directly PCR amplified and Sequenced on an Illumina NextSeq 500 platform to generate 2 x 36-bp paired-end reads.
-
bioRxiv - Neuroscience 2021Quote: ... Purified amplicons were prepared for sequencing using the Nextera XT DNA Library Preparation Kit (Illumina #FC-131-1001) using 1 ng of purified amplicon library per sample ...
-
bioRxiv - Neuroscience 2020Quote: ... Full-length cDNA was then processed with a Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). This kit aims to fragment and add adapter sequences onto template DNA with a single tube Nextera XT tagmentation reaction and so generate multiplex sequencing libraries ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA-sequencing was performed using NextSeq75 High Output v2 kit and NextSeq 500 (Illumina; cat# FC-404-2005). Using TruSeq 3’ SE adaptor sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...
-
bioRxiv - Microbiology 2022Quote: ... A second PCR step was performed with Illumina Nextera XT Index Kit v2 (Illumina, Cat.:FC-131-2001) and Ex Taq DNA Polymerase (TaKaRa Bio ...
-
bioRxiv - Physiology 2022Quote: ... Samples were pooled and sequenced on the Illumina NextSeq 500/550 High Output platform (Illumina, FC-404-2002) up to 18 samples per lane with 1% PhiX spike as a control.
-
bioRxiv - Plant Biology 2021Quote: ... the Tn5 reaction was prepared and mixed well with nuclei using the Nextera reagents (Illumina, FC-121-1030) as follows ...
-
bioRxiv - Microbiology 2020Quote: ... Libraries were pooled in equimolar concentrations and sequenced using an Illumina NextSeq 500 sequencer (Illumina, FC-404-2005). At least 95% of the reads generated presented a Q score of ≥ 30 ...
-
bioRxiv - Neuroscience 2020Quote: ... The full-length cDNA output was processed with Nextera XT DNA library preparation kit (Illumina #FC-131-1024) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... The nuclei were resuspended in the transposition reaction mix (2x TD Buffer (Illumina Cat #FC-121-1030, Nextera), 2.5⍰μl Tn5 Transposase (Illumina Cat #FC-121-1030 ...
-
bioRxiv - Genomics 2019Quote: ... equivalent to the protocol in the Illumina TruSeq PCR-Free Sample Preparation Guide (Illumina cat# FC-121-2001). Center-specific details are available from the TOPMed website82 ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were then prepared following the instructions of the TruSeq DNA Sample Preparation Kit (Illumina, #FC-121-2001) and sequenced on the HiSeq 2000 ...