Labshake search
Citations for Illumina :
401 - 450 of 652 citations for Recombinant Human 5' Nucleotidase Ecto CD73 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... total RNA from mouse gut or human donors was subjected to ribosomal RNA depletion by Ribo-Zero Plus Microbiome rRNA Depletion Kit (Illumina) and cDNA libraries were generated by using Illumina Stranded Total RNA Prep (Illumina ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was extracted with a Direct-zol RNA MicroPrep Kit and subjected to RNA-Seq library preparation using a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) followed by a TruSeq Stranded Total RNA Kit (Illumina).
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µg of total cellular RNA was depleted of ribosomal RNA (RiboZero kit, Illumina), and subjected to base hydrolysis ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1.25 µL each of i5 and i7 indexing primers (Illumina, diluted 1:5). The samples were indexed with the following PCR cycles ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Diluted libraries were spiked with 5% Phi-X control (Illumina, San Diego, CA, USA) and sequenced using the Illumina MiSeq (Illumina Inc. ...
-
bioRxiv - Molecular Biology 2022Quote: ATAC-seq was conducted on 5×104 live cells using Nextera Tn5 transposase (Illumina) as previously described (Buenrostro et al. ...
-
bioRxiv - Immunology 2022Quote: ... 5’ expression library was sequenced with NovaSeq 6000 S1 (100 cycles) (Illumina, cat. 20012865) and the V(D)J library was sequenced with NextSeq 500/550 Mid Output Kit v2.5 (300 Cycles ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 U of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 μl and incubated at 25°C for 20 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3,000 units of Quick ligase and 5 nM of annealed adaptor (Illumina truncated adaptor) in a volume of 50 µl and incubated at 25°C for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 µL of the Illumina PCR Primer Cocktail (PPC, Illumina FC-121-1030). PCR conditions were as follows ...
-
bioRxiv - Genetics 2020Quote: ... Pooled and denatured library (8 pM) containing 5% volume of PhiX (control library; Illumina) was sequenced using the Illumina MiSeq system with MiSeq Reagent Kit V3 (300-bp paired-end reads ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl Primer Cocktail (Nextera DNA Sample Preparation Kit and Nextera Index Kit, Illumina). Amplification was performed in a Veriti 96 Well Thermal Cycler (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library amplification was performed using 5 μL Nextera XT i7 forward index primer (Illumina) and 5 μL custom i5 index primers (2 μM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Genomics 2020Quote: ... CNV analysis was performed on a combined cohort of 130 sequenced hESC lines and a control cohort consisting of 243 human samples from primary blood or lymphoblastoid cell lines (LCL) that had undergone WGS on the same platform (Illumina HiSeqX) and to similar depth as the hESC lines (Pato et al. ...
-
bioRxiv - Molecular Biology 2021Quote: Libraries from human liver tissue and wild type FL83B cells were prepared with TruSeq Stranded Total RNA Library Prep Gold (Illumina, #20020599), single-read sequencing was performed using the NextSeq 500 (Illumina) ...
-
bioRxiv - Cancer Biology 2020Quote: ... We used summarized log-scale intensities representing copy number profiles generated by combining probe intensities from four platforms (Agilent Human Genome CGH Microarray 44A, Nimblegen HG19 CGH 385K WG Tiling v2.0, Affymetrix GeneChip Human Mapping 500k Array Set and Illumina Human1Mv1_C BeadChip). A threshold of ≥ 0.9 and ≤ -0.9 was used to call copy number gains and losses ...
-
bioRxiv - Molecular Biology 2020Quote: Ribosomal RNA was depleted from the total RNA using the Ribo-Zero Gold rRNA removal kit (Human/Mouse/Rat) (Illumina, USA). The ribo-depleted RNA was used to create an ssRNA-Seq library ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA-Seq libraries were prepared using TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human (RS-122-2201, Illumina Inc.) following manufacturer’s protocol ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... The bisulfite-converted DNA samples were then processed for hybridization and staining using either the Illumina Infinium Human Methylation 450 BeadChip Kit or the Illumina Infinium MethylationEPIC BeadChip Kit (Illumina Inc.) according to the manufacturer’s recommendations ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... The resulting cRNA samples were hybridized to an Illumina Human WG6 Expression BeadChip array for 14-20 hour at 58°C in an Illumina Hybridization Oven (Illumina Inc.). Arrays were washed and scanned following the protocols in the Illumina Whole-Genome Gene Expression Direct Hybridization Assay Guide (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The resulting FASTQ files were aligned to the human reference genome (build GRChg38) and transcript abundance was quantified using salmon (Illumina DRAGEN). The DESeq2 package was used to identify differentially expressed transcripts between the H3.3E50K and wildtype H3.3 expressing HMECDD cells ...
-
bioRxiv - Immunology 2021Quote: ... DRB3/4/5 kits) for sample library preparations and ran on a Miseq sequencer (Illumina), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2021Quote: ... with the libraries clustered at 12-15pM and mixed with 5% PhiX genomic DNA (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were diluted and mixed with 5-20% phiX control v3 (Illumina FC-110-3001) and sequenced with oSK326 for read 1 and oSK324 for the index read.
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5-day deligated samples were sequenced (the ligated sample was sequenced on the Illumina Nextseq500 and all others were sequenced on the Illumina Nextseq2000) ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Microbiology 2023Quote: ... all libraries were spiked with 5% PhiX Control v3 (Illumina, Catalog No. FC-110-3001). The NCBI Genbank accession number for the raw sequencing data reported here is PRJNA999749.
-
bioRxiv - Genomics 2023Quote: ... were dual-indexed using differing barcode indexes both for the forward (5’ P5 Illumina adapter) and reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Neuroscience 2021Quote: ... Genome integrity of hiPSC lines was assessed by an Illumina Human CytoSNP-12v2.1 beadchip array and analysed using KaryoStudio software (Illumina, San Diego, CA).
-
bioRxiv - Genetics 2019Quote: ... with the European individuals from the 1000G phase 3 reference panel and from the Human Genome Diversity Panel data30 (HGDP, Illumina HuHap 650k), to generate four genome-wide SNP datasets analyzed independently.
-
bioRxiv - Genetics 2021Quote: ... DNAm was then measured at 485,577 CpG sites across the genome using the Illumina Infinium Human Methylation 450K BeadChip microarray (Illumina, San Diego, CA). We received two versions of the DNAm data ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA-sequencing libraries were prepared using TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat (RS-122-2201; Illumina, CA, USA) according to manufacturers’ protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Ribosomal depleted RNA-seq libraries were prepared using the TruSeq® Stranded Total RNA Library Prep Kit Human/Mouse/Rat kit (Illumina, 20020596) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: The Illumina TruSeq Stranded Total RNA Sample Prep Kit with Ribo-Zero Human/Mouse/Rat protocol (Illumina, Inc. San Diego, CA, USA) was used for the following steps ...
-
bioRxiv - Developmental Biology 2021Quote: ... and the resulting nuclear pellet was resuspended in 5 µl buffer TD (Illumina, San Diego, CA) and combined with 2.5 µl H2O and 2.5 µl Tn5 transposase (Tagment DNA Enzyme ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μg DNase-treated RNA was used as input for ribosomal depletion using the Epicentre (Illumina) Ribo-Zero ribosomal depletion kit (Cat# SCL24H) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified mRNA 5′ end libraries were multiplexed again and then sequenced on HiSeq 4000 (Illumina) using paired-end (2x 100 cycles ...
-
bioRxiv - Developmental Biology 2022Quote: ... Completed libraries were pooled in an equimolar ratio along with 5% PhilX Control Library V3 (Illumina), denatured and diluted to 2.0pM as per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... parental fish were whole-genome sequenced with 5–10X coverage (Illumina Hiseq platforms, BGI Hong Kong). The genotyping of F1 fish was carried out with the DarTseq technology (Diversity Arrays Technology ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the resulting nuclear pellet was resuspended in 5 µl buffer TD (Illumina, San Diego, CA) and combined with 2.5 µl H2O and 2.5 µl Tn5 transposase (Tagment DNA Enzyme ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 pM of DNA library spiked with .5% PhiX viral DNA was clustered on cBot (Illumina) and then sequenced on a HiScanSQ module (Illumina).
-
bioRxiv - Immunology 2021Quote: SNP-array copy number profiling and analysis of regions of homozygosity were performed on DNA isolated from WT and CRISPR-Cas9 edited LCLs (ERAP2-KO) according to standard procedures using the Infinium Human CytoSNP-850K v1.2 BeadChip (Illumina, San Diego, CA, USA). Samples were scanned using the iScan system (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... and patient-derived LCLs was used for SNP-array copy number profiling and analysis of regions of homozygosity with the Infinium Human CytoSNP-850K v1.2 BeadChip (Illumina, San Diego, CA, USA). This array has ∼850,000 single nucleotide polymorphisms (SNPs ...
-
bioRxiv - Genomics 2019Quote: DNA was extracted and genotyped from a total of 867 samples (START mothers) using the Illumina Human CoreExome-24 and Infinium CoreExome-24 arrays (Illumina, San-Digeo, CA, USA). Data was cleaned using standard quality control (QC ...