Labshake search
Citations for Illumina :
401 - 450 of 9025 citations for Human NADH ubiquinone oxidoreductase chain 5 MT ND5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... then 4 pM of the pooled library with 5% PhiX v3 control (Illumina, USA) was loaded onto an Illumina MiSeq instrument and sequenced using MiSeq V3 chemistry ...
-
bioRxiv - Cancer Biology 2023Quote: ... Library amplification was performed using 5 μL Nextera XT i7 forward index primer (Illumina) and 5 μL custom i5 index primers (2 μM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... with the « NEBNext® Ultra™ II DNA Library Prep Kit » kit (Illumina®). Paired-end sequencing was performed in on a HiSeq1500 (Illumina® ...
-
bioRxiv - Microbiology 2019Quote: ... machine with the NextSeq® 500 Mid Output Kit v2 kit (150 cycles) (Illumina), to generate read of 150 bp.
-
bioRxiv - Systems Biology 2023Quote: ... with a 300 bp paired-end reads sequencing kit (MiSeq Reagent Kit v3; Illumina). The raw data from the MiSeq instrument in the gz compressed FASTQ format were analyzed with several bioinformatics tools in the Linux operating system ...
-
bioRxiv - Microbiology 2023Quote: ... using the Illumina DNA Prep kit and unique dual indexes (Illumina Nextera Index kit) at 1:4 scale reaction volume ...
-
bioRxiv - Genomics 2020Quote: ... CNV analysis was performed on a combined cohort of 130 sequenced hESC lines and a control cohort consisting of 243 human samples from primary blood or lymphoblastoid cell lines (LCL) that had undergone WGS on the same platform (Illumina HiSeqX) and to similar depth as the hESC lines (Pato et al. ...
-
bioRxiv - Molecular Biology 2021Quote: Libraries from human liver tissue and wild type FL83B cells were prepared with TruSeq Stranded Total RNA Library Prep Gold (Illumina, #20020599), single-read sequencing was performed using the NextSeq 500 (Illumina) ...
-
bioRxiv - Cancer Biology 2020Quote: ... We used summarized log-scale intensities representing copy number profiles generated by combining probe intensities from four platforms (Agilent Human Genome CGH Microarray 44A, Nimblegen HG19 CGH 385K WG Tiling v2.0, Affymetrix GeneChip Human Mapping 500k Array Set and Illumina Human1Mv1_C BeadChip). A threshold of ≥ 0.9 and ≤ -0.9 was used to call copy number gains and losses ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... The resulting cRNA samples were hybridized to an Illumina Human WG6 Expression BeadChip array for 14-20 hour at 58°C in an Illumina Hybridization Oven (Illumina Inc.). Arrays were washed and scanned following the protocols in the Illumina Whole-Genome Gene Expression Direct Hybridization Assay Guide (Illumina) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The resulting FASTQ files were aligned to the human reference genome (build GRChg38) and transcript abundance was quantified using salmon (Illumina DRAGEN). The DESeq2 package was used to identify differentially expressed transcripts between the H3.3E50K and wildtype H3.3 expressing HMECDD cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... (M) Tagmentation kit (Illumina, 20018705), with 6 cycles of amplification ...
-
bioRxiv - Genomics 2019Quote: ... and Mate-pair Kit (Illumina), respectively ...
-
bioRxiv - Genomics 2020Quote: ... 500 cycle kit (Illumina, UK) at an 8 pM loading concentration with a 10 % PhiX spike-in ...
-
bioRxiv - Microbiology 2020Quote: ... and NexternaRTM Index Kit (Illumina). All cultured isolates (n=43 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... library preparation (Illumina TruSeq kit), and sequencing (Illumina Hi-Seq ...
-
bioRxiv - Physiology 2022Quote: TruSeq mRNA library kit (Illumina) was used to prepare the mRNA library following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... using Swiftbio kit from Illumina. In brief ...
-
bioRxiv - Molecular Biology 2022Quote: TruSeq Stranded mRNA kit (Illumina) was used for library preparation from total RNA according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: Nextera XT V2 kit (Illumina) sequencing libraries were prepared using 1.5ng of amplified cDNA as per manufacturer’s instructions and sequenced on a 2×150 bp-paired end Illumina MiSeq run ...
-
bioRxiv - Microbiology 2021Quote: ... TruSeq Stranded mRNA kit (Illumina) was used for subsequent steps of cDNA strand synthesis ...
-
bioRxiv - Microbiology 2020Quote: ... The Nextera XT kit (Illumina) was used for library preparation and sequencing was performed using a MiSeq v2 cartridge on a MiSeq sequencer (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ... and Nextera Index Kit (Illumina) primers followed by reverse phase 0.65 x SPRI beads purification and a QIAquick Spin Column (QIAGEN ...
-
bioRxiv - Molecular Biology 2022Quote: ... (M) Tagmentation kit (Illumina, 20018705), with 6 cycles of amplification ...
-
bioRxiv - Microbiology 2022Quote: ... Kapa Library Quant kit (Illumina) and Universal qPCR mix (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... the RiboZero Bacteria Kit (Illumina) was used as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... (M) Tagmentation Kit (Illumina, Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... MiSeq Reagents Kit v3 (Illumina) were used according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... the Nextera XT kit (Illumina) was used in a paired-end (2×300 bp ...
-
bioRxiv - Molecular Biology 2023Quote: ... 75-cycle kits (Illumina #20024906).
-
bioRxiv - Genomics 2023Quote: ... The Nextera HT kit (Illumina) was used to convert cDNA libraries into sequencing libraries with the addition of a UMI-specific primer to amplify the cDNA ends containing molecular barcodes as described in the Smart-seq3 protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100 cycles kit (Illumina, USA). The output was ∼ 25 million single end- 120 bp reads per sample.
-
bioRxiv - Microbiology 2023Quote: ... using the RiboZERO Kit (Illumina), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 300 cycle reagent Kit (Illumina) in a paired-end fashion (150 × 2).
-
bioRxiv - Genomics 2023Quote: ... using NovaSeq Reagent Kits (Illumina) and the SBS (Sequence By Synthesis ...
-
bioRxiv - Microbiology 2024Quote: ... The Nextera XP kit (Illumina) was used to prepare the sequencing library for sequencing on the HiSeq 2500 and NextSeq 1000 instruments (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... Ribo-Zero Plus Kit (Illumina) was employed for host ribosomal RNA depletion ...
-
bioRxiv - Microbiology 2024Quote: ... (M) Tagmentation Kit (Illumina Co.), and sequencing was run with the MiSeq Reagent Kit v3 (2 × 300 bp) ...
-
bioRxiv - Pathology 2021Quote: ... with the libraries clustered at 12-15pM and mixed with 5% PhiX genomic DNA (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were diluted and mixed with 5-20% phiX control v3 (Illumina FC-110-3001) and sequenced with oSK326 for read 1 and oSK324 for the index read.
-
bioRxiv - Genomics 2022Quote: ... n = 5 Illumina-sequenced datasets and n = 1 WGS of normal DNA (PBMC, Illumina sequencing). Variants were identified in all datasets using lofreq67 (without filtering ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5-day deligated samples were sequenced (the ligated sample was sequenced on the Illumina Nextseq500 and all others were sequenced on the Illumina Nextseq2000) ...
-
bioRxiv - Microbiology 2023Quote: ... all libraries were spiked with 5% PhiX Control v3 (Illumina, Catalog No. FC-110-3001). The NCBI Genbank accession number for the raw sequencing data reported here is PRJNA999749.
-
bioRxiv - Genomics 2023Quote: ... were dual-indexed using differing barcode indexes both for the forward (5’ P5 Illumina adapter) and reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Cancer Biology 2022Quote: Libraries were prepared using the Library Prep kit (Illumina TruSeq RNA Sample prep kit v2) and were run on an Illumina NextSeq500 platform using the High Output v2 75cycles (2×36cycle Paired End ...
-
bioRxiv - Immunology 2020Quote: ... Library amplification was performed using Nextera DNA library prep kit with Nextera Index Kit (Illumina) as per manufacturers instruction ...
-
bioRxiv - Microbiology 2022Quote: The Nextera DNA Preparation Kit and the Nextera Index Kit (Illumina, San Diego, CA, USA) were used to prepare the DNA Libraries following the manufacturer’s instructions with a few modifications ...
-
bioRxiv - Cancer Biology 2022Quote: ... using NextSeq 500/550 High Output Kit v2.5 (75 Cycles) Reagent Kit (PN 20024906, Illumina). The data was analyzed using the Python package Scanpy ...