Labshake search
Citations for Illumina :
401 - 450 of 8814 citations for Human Bcl2 Associated Death Promoter BAD ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... with Ribo-Zero Complete Globin kit (Illumina) following manufacturer’s recommendations and indices were added to multiplex the data ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and sequenced with a MiSeq kit (Illumina).
-
bioRxiv - Genomics 2020Quote: ... using Miseq reagent V2 Nano kit (Illumina). We utilized the Bismark tool (Krueger & Andrews ...
-
bioRxiv - Immunology 2021Quote: ... The TruSeq RNA Stranded sample kit (Illumina) was used to construct the sequencing libraries ...
-
bioRxiv - Systems Biology 2020Quote: ... using TruSeq SBS Kit v4 reagents (Illumina).
-
bioRxiv - Neuroscience 2021Quote: ... and Illumina Nextera XT kit (Illumina Inc.). 2 ⨯ 75 paired-end ...
-
bioRxiv - Cell Biology 2020Quote: ... Nextera XT DNA Library Prep Kit (Illumina) was use to finalize the libraries ...
-
bioRxiv - Cancer Biology 2020Quote: ... 75 cycle kit (Illumina, FC-404-2005) with PhiX Run Control (Illumina ...
-
bioRxiv - Cancer Biology 2020Quote: ... Nextera XT DNA Library Preparation Kit (Illumina) and i7 Index Primer (Nextera XT Index Kit ...
-
bioRxiv - Plant Biology 2021Quote: ... and Illumina Mate Pair Library kit (Illumina) following the manufacturer’s instructions (Supplemental Table S1) ...
-
bioRxiv - Plant Biology 2021Quote: ... and the Ribo-Zero Plant Kit (Illumina). Libraries were paired-end sequenced on an Illumina HiSeq3000 instrument ...
-
bioRxiv - Systems Biology 2020Quote: ... Illumina’s TruSeq Exome kit (Illumina, Cat: 20020615) was utilized per manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... Nextera DNA Library Preparation Kit (Illumina, Inc.) was used for Illumina MiSeq® sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... and sequenced with the 300V2 Kit (Illumina) in Illumina MiSeq (Illumina) ...
-
bioRxiv - Microbiology 2020Quote: ... the TruSeq Nano DNA LT Kit (Illumina). Libraries were quantified using a BioAnalyzer (Agilent ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the TruSeq SBS Kit v3 (Illumina). Sequence reads were aligned and counted for each gene by RSEM algorithm (26 ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the HiSeq SBS Kit v4 (Illumina). An average of 58 million paired reads was generated per sample ...
-
bioRxiv - Neuroscience 2022Quote: ... using the mRNA TrueSeq Stranded kit (Illumina). mRNAseq libraries were sequenced on a NextGen550 on a 75 cycles flow cell (Illumina) ...
-
bioRxiv - Genetics 2022Quote: ... depleted of rRNA (Illumina RiboZero Gold kit), and prepared into reverse-stranded libraries (Roche KAPA kit) ...
-
bioRxiv - Bioengineering 2022Quote: ... using the Miseq v2 reagent kit (Illumina) or Miseq Reagent kit v2 Nano (illumina ...
-
bioRxiv - Bioengineering 2021Quote: ... The Ribo Zero rRNA Removal Kit (Illumina) was used to deplete rRNA from the samples ...
-
bioRxiv - Neuroscience 2021Quote: ... the TruSeq stranded RNA kit (Illumina Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... 75 cycle kit (Illumina, FC-404-2005).
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... and the MiSeq Reagent Kit v3 (Illumina). DNA libraries were prepared using the Nextera XT DNA Preparation Kit (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... TruSeq Stranded mRNA sample preparation kit (Illumina) was used for the preparation of the library for RNA-seq data analysis ...
-
bioRxiv - Microbiology 2022Quote: Ribo-Zero rRNA Removal bacterial Kit (Illumina) was used to deplete the ribosomal rRNA from all samples as described in the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... using HiSeq Rapid SBS Kit v2 (Illumina). The average number of read pairs per sample was 61 million ...
-
bioRxiv - Molecular Biology 2022Quote: The TruSeq Small RNA Prep Kit (Illumina) was used to prepare small RNA libraries from RNA pyrophosphohydrolase (Rpph ...
-
bioRxiv - Cancer Biology 2022Quote: ... The TruSeq ChIP Library Preparation Kit (Illumina) was used for library preparation ...
-
bioRxiv - Neuroscience 2020Quote: ... with a Nextera XT DNA kit (Illumina). Libraries were multiplexed on two high-output flow cells and sequenced (75 bp reads ...
-
bioRxiv - Microbiology 2020Quote: ... V2x500 or V3x600 sequencing kits (Illumina, USA), always generating 283bp size amplicons suitable for analysis ...
-
bioRxiv - Microbiology 2021Quote: ... the ribozero Removal Kit was used (Illumina). The NEBNext Ultra II RNA Library Prep Kit (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... barcoded by using the Nextera kit (Illumina), and pooled in one lane of an Illumina HiSeq2500 for sequencing ...
-
bioRxiv - Genomics 2021Quote: ... using TruSeq SBS Kit v4 reagents (Illumina). The RNA-seq experiment was performed in two replicates for each sample distributed across 8 lanes ...
-
bioRxiv - Genomics 2021Quote: ... with a NextSeq High Output kit (Illumina) platform with 2 x 150 read length.
-
bioRxiv - Immunology 2021Quote: ... TruSeq stranded mRNA Library prep kit (Illumina) and Truseq RNA Unique Dual Indexed Adapters (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... the TruSeq stranded RNA kit (Illumina Inc.) was used according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2021Quote: ... the TruSeq stranded RNA kit (Illumina Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: The Nextera DNA Library Prep Kit (Illumina) was used to prepare sequence libraries with 25 ng of input DNA ...
-
bioRxiv - Genomics 2020Quote: ... RNA Library Prep Kit v2 from Illumina® (Illumina Inc. ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the TruSeq stranded mRNA kit (Illumina) to enrich for polyadenylated transcripts ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... mid Output 150 cycles kits (Illumina®) for 2 × 75 bp PE reads ...
-
bioRxiv - Microbiology 2021Quote: ... the Ribo-Zero rRNA removal kit (Illumina) was used without deviations from the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using a MiSeq v3 Reagent Kit (Illumina) and 2 × 300 bp paired end sequencing ...
-
bioRxiv - Immunology 2021Quote: ... using the v3 MiSeq Reagent Kit (Illumina). 16S data were analyzed using QIIME 2 (3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... TruSeq SBS Kit v3-HS (Illumina, USA).
-
bioRxiv - Immunology 2020Quote: ... with the Ribo-Zero Gold kit (Illumina) for ribosomal depletion ...
-
bioRxiv - Immunology 2020Quote: ... employing Illumina MiSeq v2 Reagent Kit (Illumina). For the analysis of TCR sequencing data ...
-
bioRxiv - Immunology 2020Quote: ... Indices from the Nextera Index Kit (Illumina), followed by adaptors P1 (AATGATACGGCGACCACCGA ...