Labshake search
Citations for Illumina :
401 - 450 of 683 citations for 5 Isoxazolol 4 methyl 3 trifluoromethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μg total RNA per sample were used for the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina) to generate cDNA libraries according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... The additional 71 ASH donors were genotyped separately at 4,327,108 SNPs with the Infinium Omni5-4 v1.2 BeadChip (Illumina, California). We updated SNP identifiers based on Illumina annotation files (https://support.illumina.com/content/dam/illumina-support/documents/downloads/productfiles/humanomni5-4/v1-2/infinium-omni5-4-v1-2-a1-b144-rsids.zip ...
-
bioRxiv - Immunology 2022Quote: ... High-resolution 4-digit HLA typing was performed with the TruSight HLA v2 Sequencing Panel kit from Illumina according to the manufacturer instruction ...
-
bioRxiv - Microbiology 2022Quote: ... Six samples per condition containing 4 μg of total RNA were used for TruSeq mRNA library preparation (Illumina) after being treated with Globin-Zero Gold rRNA Removal Kit (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... indexed using IDT for Illumina Nextera UD indexes Sets 1–4 (384 Indexes, Cat no: 20043137, Illumina, USA) and products were amplified ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were pooled together and sequenced using 75bp paired-end chemistry across 4 lanes of a Hiseq4000instrument (Illumina) to achieve 10 million reads per sample ...
-
bioRxiv - Cell Biology 2020Quote: ... an oligonucleotide containing the Illumina P7 adaptor sequence was ligated to the 3’ end of the single stranded LAM PCR fragments using Circligase (Epicentre/Illumina, #CL9025K). A P5 adaptor was added by PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Sequencing libraries (1.3 nM) were chemically denatured and applied to an Illumina NovaSeq flow cell using the NovaSeq XP chemistry workflow (Illumina-20021664). Following transfer of the flowcell to an Illumina NovaSeq instrument ...
-
bioRxiv - Neuroscience 2020Quote: ... The cell solutions were immediately transferred to ice and transported to the Wellcome Trust Centre for Human Genetics (WTCHG) for scRNAseq via 10x genomics chromium (10x genomics, US) (Single Cell 3’ v3) and Illumina hiseq 4000 (Illumina, US). This approach achieved 66-72K mean reads per cell and a sequencing depth of 53-55% per cell before filtering.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was extracted and sequence reads (100 bp paired-end) were generated with Illumina TruSeq high output version 3 chemistry on a HiSeq 2500 (Illumina, Inc.) at NRC-Plant Biotechnology Institute (NRC-PBI) ...
-
bioRxiv - Cancer Biology 2020Quote: ... TN5 tagmentation and library amplification realized 3’end fragments by Nextera XT DNA Sample Preparation Kit (Illumina, Cat#FC-131-1024) according to the manufacturer’s instructions while P5_TSO and Nextera_N7xx took the place of the custom primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... 500 ng of total RNA were used as input for QuantSeq (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina; Lexogen) following the autoQuantSeq automated workflow ...
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were processed according to the standard 10x Chromium 3’ workflow and pooled before sequencing over two lanes (Illumina HiSeq 4000).
-
bioRxiv - Genomics 2019Quote: ... The resulting libraries always contain dual-indexes in the standard indexing positions and may optionally contain additional internal indexes (Figs. 1–3; Table 1; Illumina, 2018b). These indexes are recovered through the four standard separate sequencing reactions generated by Illumina instruments when doing paired-end sequencing (Fig ...
-
bioRxiv - Cancer Biology 2019Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters from TruSeq™ Stranded Total RNA Sample Preparation Kit with Ribo-Zero Gold (Illumina) were ligated.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng alkylated RNA was used and prepared with a commercially available kit (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina NovaSeq SP platform in 100bp-single-read mode.
-
bioRxiv - Genomics 2021Quote: ... and 1µM Dexamethasone or 0.1% ethanol for 3 hours. Transposition was performed using the OmniATAC protocol (Corces et al. 2017) and the tagment DNA TDE1 enzyme (Illumina, 20034197). DNA was purified using the MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: The input samples were submitted to the Washington University Genome Technology Access Center to obtain and sequence the cDNA libraries (10XGenomics, 3’v3.1; Illumina NovaSeq S4) according to established protocols ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 x 105 mESCs and 5 x 104 S2 cells were resuspended in Tagment DNA Buffer and treated with 3 µL TDE1 Tagment DNA Enzyme (Illumina 20034197). After thorough mixing ...
-
bioRxiv - Genomics 2023Quote: For all tandem repeat identification and quantification we used DNA sequences from 2,504 individuals from the Phase 3 of the 1,000 Genomes Project (∼30x coverage Illumina short-read data) (Byrska-Bishop et al ...
-
bioRxiv - Genomics 2023Quote: ... 200ng alkylated RNA were used as input for generating 3’-end mRNA sequencing libraries using a commercially available kit (QuantSeq 3ʹ mRNA-Seq Library Prep Kit FWD for Illumina, Lexogen).
-
bioRxiv - Immunology 2024Quote: ... 2024) using the command CreateSeuratObject with the following parameters: min.cells = 3 and either min.features = 200 (for Illumina reads from MBC gate) or min.features = 100 (for the Oxford Nanopore reads from the ASC gate) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Then the scRNA-seq libraries were constructed by using the Chromium Next GEM Single Cell 3’ Reagent Kits v3 (10X Genomics, USA) and sequenced by using the sequencer Novaseq6000 (Illumina, USA). All procedures were following the manufacturer’s protocol.
-
bioRxiv - Genetics 2021Quote: ... We find that even sequencing error rates as high as 5% (50x higher than Illumina sequencer error) have very little effect on clustering quality under most correlation cut-offs ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were sequenced (5’ single end; single-end 75x) using the NextSeq500 high-throughput sequencing system (Illumina) at the Cornell University Biotechnology Resource Center ...
-
A New Gene Set Identifies Senescent Cells and Predicts Senescence-Associated Pathways Across TissuesbioRxiv - Cell Biology 2021Quote: ... and 2-5 cm inferior to the navel.24,38 Sequencing was performed on a HiSeq2000 (Illumina®), fastq files were mapped to the human reference genome hg19 ...
-
bioRxiv - Cell Biology 2021Quote: ... The purified DNA was PCR amplified for 5 cycles using a Nextera DNA Library Index kit (Illumina) and Phusion HF Master Mix (New England BioLabs ...
-
bioRxiv - Microbiology 2020Quote: ... was performed with ~5 million reads / sample in single-end mode on the NextSeq 500 platform (Illumina), using the High Output Kit v2.5 (75 cycles) ...
-
bioRxiv - Microbiology 2021Quote: ... Approximately 5 μg total RNA samples were treated with the Ribo-Zero™ rRNA removal procedure (Illumina) to enrich for mRNA ...
-
bioRxiv - Microbiology 2020Quote: ... cells were lysed in ATAC lysis buffer for 5 min and then transposed with TN5 transposase (Illumina) for 30 min ...
-
bioRxiv - Genomics 2022Quote: ... We partitioned the genes into three categories: (1) >5-fold higher in Illumina (“Higher count in Illumina”); (2 ...
-
bioRxiv - Biochemistry 2020Quote: 5 µg total RNA isolated from Flag elution samples were treated with Yeast RiboZero Gold (Illumina, MRZY1306) according to the manufacturer’s instructions to remove yeast rRNAs from the samples ...
-
bioRxiv - Cancer Biology 2020Quote: ... The 5’GEX libraries were sequenced each of on a separate lane of HiSeq4000 flow cell (Illumina) to target sequencing depth of 50,000 read pairs per sample ...
-
bioRxiv - Immunology 2022Quote: ... cells were lysed in ATAC lysis buffer for 5 minutes and then transposed with TN5 transposase (Illumina) for 30 minutes at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Approximately 5 μg total RNA samples were treated with the Ribo-Zero™ rRNA removal procedure (Illumina) to enrich for mRNA ...
-
bioRxiv - Plant Biology 2022Quote: ... and 5 mM β-mercaptoethanol) and then subjected the nuclei to a transposition reaction with Tn5 (Illumina). The transposition reaction was performed with 25 μl of 2x DMF (66 mM Tris-acetate pH 7.8 ...
-
bioRxiv - Microbiology 2023Quote: ... Approximately 5 million 75-nt single reads per sample were determined using a NextSeq High Output (Illumina), with >96% of the reads having a Q30 quality.
-
bioRxiv - Cancer Biology 2023Quote: ... Samples that qualified (RIN>5) were prepped using the standard protocol for Illumina Stranded mRNA prep (Illumina). Sequencing was done using the Illumina NextSeq 2000 with paired-end 59 bp × 59 bp reads ...
-
bioRxiv - Molecular Biology 2022Quote: ... or purified chromosomes (2 x 106 pelleted at 10,000g for 10min at 4°C) were resuspended in 50 μl transposase mixture (25 μl Illumina TD buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... 4 nM of this pool were loaded on a high output flowcell and sequenced on a NextSeq500 platform (Illumina) with 2×75nt paired-end chemistry.
-
bioRxiv - Systems Biology 2019Quote: ... We sequenced to a depth of at least 500,000 reads per RNA sequencing library (with a typical depth of around 4 million reads) on a NextSeq500 (Illumina). While we targeted 48 clones and 48 controls for each cell line ...
-
bioRxiv - Immunology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Microbiology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were pooled into a 4 nM solution and sequenced on the Illumina MiSeq platform (Illumina; San Diego; CA) with a target sequencing yield of 500MB-1GB per virome.
-
bioRxiv - Neuroscience 2023Quote: ... 4 saline) were pooled at equimolar concentrations and run with 75 bp paired-end reads on the MiSeq (Illumina).
-
bioRxiv - Evolutionary Biology 2021Quote: ... we combined 3 μl of each sample (approx 2.24 ng) with a small quantity of a Nextera™ tagment DNA enzyme (Illumina catalogue #15027865). To decrease costs ...
-
bioRxiv - Microbiology 2021Quote: ... The libraries were sequenced using an Illumina MiSeq with MiSeq Reagent Kit v.3 (2x 300 bp, Illumina, San Diego, CA, USA) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... The quantitative 3-step real-time PCR was performed by the Eco Real-Time PCR system (Illumina Inc., San Diego CA, USA) and CFX Connect (Bio-Rad Laboratories AG ...
-
bioRxiv - Genetics 2019Quote: ... with the European individuals from the 1000G phase 3 reference panel and from the Human Genome Diversity Panel data30 (HGDP, Illumina HuHap 650k), to generate four genome-wide SNP datasets analyzed independently.