Labshake search
Citations for Illumina :
401 - 450 of 1992 citations for 5 Chloro 1 vinyl 2 pyridone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: Paired-end sequencing (2 x 75bp) was performed on a NextSeq 500 (Illumina) with SMART-Seq Stranded Kits (Takara Bio ...
-
bioRxiv - Cancer Biology 2022Quote: ... Hi-C libraries were sequenced 2×150bp on a NovaSeq 6000 instrument (Illumina). Juicer were used to process raw reads and generate Hi-C contact matrices (.hic files) ...
-
bioRxiv - Microbiology 2022Quote: ... Sequencing reactions were carried out using MiSeq v2 (2×150 bp) chemistry (Illumina) on a MiSeq instrument (Illumina ...
-
bioRxiv - Plant Biology 2022Quote: ... and sequencing (paired-end, 2 × 151 cycles, Illumina NovaSeq6000 system at IPK Gatersleben) involved standard protocols from the manufacturer (Illumina Inc. ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing is performed using the 2*300 MiSeq Reagent Kit v3 (Illumina, Inc.).
-
bioRxiv - Cell Biology 2024Quote: ... the final pool diluted to 2 nM and sequenced on NovaSeq 6000 (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... and subjected to Illumina MiSeq 2 × 150 bp paired-end sequencing by Illumina MiSeq.
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was performed by GenoScreen (Lille, FR) on MiSeq (Illumina 2*250 bp) using the MiSeq reagent kit v2 (500 cycles).
-
bioRxiv - Neuroscience 2024Quote: ... and sequenced on Novaseq 6000 (2×150 paired end, Illumina, San Diego, CA). Data in FASTQ format was quality checked by fastqc software ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA library preparation and sequencing (Illumina Novaseq SP, 2 × 50 bp read length). Differential expression was filtered by selecting transcripts with fold change ≥ |1.5| and a significance level of P ≤ 0.05 using PartekFlow.
-
bioRxiv - Genomics 2023Quote: ... combining the use of 10X linked short reads (Illumina NovaSeq 6000, 2×150bp) for base accuracy ...
-
bioRxiv - Microbiology 2023Quote: ... amplicons were sequenced for 2□×□150 paired-end reads with MiSeq Sequencing (Illumina). The CRISPResso software was used to analyze the deep sequencing data 32.
-
bioRxiv - Molecular Biology 2023Quote: ... primarily as paired end 2 × 151 read multiplex runs on MiSeq platform (Illumina). We used the ShapeMapper2 algorithm [17] to determine the mutation frequency in chemically modified (5NIA ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were paired end sequenced (2×301 bp) on a MiSeq (Illumina) using a MiSeq Reagent kit v3 ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were paired-end sequenced (2×300 bp) on a MiSeq (Illumina) using a MiSeq Reagent kit v3 (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... libraries were pooled and sequenced on NovaSeq S4 2×150-bp run (Illumina). Mapping to the human hg38 genome and peak calling were performed using the ENCODE ATAC-seq pipeline.
-
bioRxiv - Immunology 2022Quote: ... Sequencing was carried out on a Novaseq6000 S2 2×50bp flow cell (Illumina) utilizing the Chromium single-cell 5′ and TCR gene expression library preparation (10X Genomics) ...
-
bioRxiv - Microbiology 2023Quote: ... and sequencing using an Illumina MiSeq (v2, 2 × 150 bp) instrument (Illumina, USA).
-
bioRxiv - Immunology 2023Quote: ... cDNA libraries were generated using the TruSeq Sample Preparation v.2 Guide (Illumina) and paired end-sequenced on the NovaSeq 6000 (Illumina) ...
-
bioRxiv - Immunology 2023Quote: ... cDNA Libraries were generated using the TruSeq Sample Preparation v.2 Guide (Illumina) and paired end-sequenced on the NovaSeq 6000 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were sequenced using 2 × 300 bp paired end v3 reagent kit (Illumina), following manufacturer’s protocols ...
-
bioRxiv - Plant Biology 2023Quote: ... Paired-end sequencing (2 × 150 bp) was conducted on the NovaSeq 6000 (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... and sequenced on an Illumina HiSeq with 2×150 bp sequencing configuration (Illumina).
-
bioRxiv - Cell Biology 2024Quote: ... in paired-end mode (2×40 cycles) and a NextSeq 2000 instrument (Illumina) in paired-end mode (2×50 cycles) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and sequenced on a NovaSeq using the 2 x 150 bp protocol (Illumina) for approximately 25-30 million reads per sample ...
-
bioRxiv - Microbiology 2024Quote: ... Whole genome sequencing was performed in Novaseq platform (Illumina, 2×150 paired-end), obtaining a Q30 of 91.99% and an estimated sequencing coverage of 890X.
-
bioRxiv - Microbiology 2024Quote: ... Sequencing was performed using the NextSeq 500 platform (2 by 75 bp, Illumina) with 10 to 15 million reads per sample.
-
bioRxiv - Physiology 2024Quote: ... Sequencing is performed for 2 x 125 cycles on a HiSeq 2500 (Illumina) using the SBS V4 chemistry (Sequencing by Synthesis) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and sequenced (>25M 100-bp paired-end (2×100) reads on NovaSeq (Illumina)) with the Yale Center for Genome Analysis (YCGA) ...
-
bioRxiv - Immunology 2021Quote: ... DRB3/4/5 kits) for sample library preparations and ran on a Miseq sequencer (Illumina), following the manufacturer’s instructions.
-
bioRxiv - Pathology 2021Quote: ... with the libraries clustered at 12-15pM and mixed with 5% PhiX genomic DNA (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were diluted and mixed with 5-20% phiX control v3 (Illumina FC-110-3001) and sequenced with oSK326 for read 1 and oSK324 for the index read.
-
bioRxiv - Cell Biology 2023Quote: ... and 5-day deligated samples were sequenced (the ligated sample was sequenced on the Illumina Nextseq500 and all others were sequenced on the Illumina Nextseq2000) ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Microbiology 2023Quote: ... all libraries were spiked with 5% PhiX Control v3 (Illumina, Catalog No. FC-110-3001). The NCBI Genbank accession number for the raw sequencing data reported here is PRJNA999749.
-
bioRxiv - Genomics 2024Quote: ... were dual-indexed using differing barcode indexes both for the forward (5’ P5 Illumina adapter) and reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1,6 pM of libraries with 5% PhiX was then loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Developmental Biology 2021Quote: ... and the resulting nuclear pellet was resuspended in 5 µl buffer TD (Illumina, San Diego, CA) and combined with 2.5 µl H2O and 2.5 µl Tn5 transposase (Tagment DNA Enzyme ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μg DNase-treated RNA was used as input for ribosomal depletion using the Epicentre (Illumina) Ribo-Zero ribosomal depletion kit (Cat# SCL24H) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified mRNA 5′ end libraries were multiplexed again and then sequenced on HiSeq 4000 (Illumina) using paired-end (2x 100 cycles ...
-
bioRxiv - Developmental Biology 2022Quote: ... Completed libraries were pooled in an equimolar ratio along with 5% PhilX Control Library V3 (Illumina), denatured and diluted to 2.0pM as per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... parental fish were whole-genome sequenced with 5–10X coverage (Illumina Hiseq platforms, BGI Hong Kong). The genotyping of F1 fish was carried out with the DarTseq technology (Diversity Arrays Technology ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the resulting nuclear pellet was resuspended in 5 µl buffer TD (Illumina, San Diego, CA) and combined with 2.5 µl H2O and 2.5 µl Tn5 transposase (Tagment DNA Enzyme ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 pM of DNA library spiked with .5% PhiX viral DNA was clustered on cBot (Illumina) and then sequenced on a HiScanSQ module (Illumina).
-
bioRxiv - Genomics 2024Quote: ... with 5 μM forward and reverse primers in an Eco™ Real-Time PCR system (Illumina). qPCR primers were synthesized as follow ...
-
bioRxiv - Biophysics 2021Quote: ... with 2×150bp dual index 300 cycle MiSeq Nano Kit V2 (Illumina cat#15036522) with 20% PhiX (Illumina cat#FC-110-3001 ...
-
bioRxiv - Cell Biology 2020Quote: ... The libraries were sequenced in 2 × 100 nt manner on HiSeq 2000 platform (Illumina).
-
bioRxiv - Developmental Biology 2021Quote: ... sequencing was progressed as paired-end (2×150bp) using Illumina NovaSeq6000 (Illumina, CA, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... Paired end reads (2×150 bp) were generated on a HiSeq 4000 instrument (Illumina). Reads were aligned to the human genome (hg38 ...