Labshake search
Citations for Illumina :
401 - 450 of 1884 citations for 4' Bromo 3 2 5 dimethylphenyl 3' fluoropropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Illumina sequencing libraries were generated for 5 αHHβHH mice and 5 αLLβHL mice using TruSeq RNA Sample Preparation Kit v2 (Illumina, San Diego, CA, USA) and sequenced on an Illumina HiSeq2500 platform ...
-
bioRxiv - Genomics 2024Quote: ... Two libraries were pooled and sequenced on a NextSeq 550 using High Output Kit v2.5 (300 Cycles: 146 read 1, 18 index 1, 8 index 2, 146 read 2) (Illumina) according to the manufacturers protocol ...
-
bioRxiv - Genetics 2021Quote: ... 5 µl water) with 2.5 µl transposase (Illumina 20034197) for 30 min at 37 °C with shaking at 1000 r.p.m ...
-
bioRxiv - Neuroscience 2020Quote: ... An additional 5 samples were sequenced on MiSeq (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... spiked with 5% PhiX pre-made library from Illumina and loaded on a Miseq v3 kit (Illumina Inc. ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl PPC (Illumina Nextera DNA Sample Preparation Kit) and 20 μl DNA ...
-
bioRxiv - Immunology 2022Quote: ... mixed with 5% PhiX and sequenced on MiSeq (Illumina) using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Genomics 2023Quote: ... 5 µL Tn5 transposase (Illumina Cat FC-121-1030) and 22,5 µL nuclease-free H2O and incubated at 37 °C for 30 mins ...
-
bioRxiv - Microbiology 2023Quote: ... A 5% PhiX control (Illumina, San Diego, CA, USA) along with positive (DNA sample extracted from the healthy gut ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 5 µM RT Primer (RTP, TruSeq kit; Illumina) was then performed according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2021Quote: ... Genotyping of the VRC cohort and imputation of genetic variants are described in detail elsewhere.55 We interrogated 7,637,921 variants (imputed from 2,783,635 genetic variants with a minor allele frequency ≥ 5%, measured using the Illumina Human Omni 5 BeadChip array, GRCh37) for an association with each of the 166 ToxScan peptides using the penalized quasi-likelihood (PQL ...
-
bioRxiv - Genomics 2022Quote: ... The library was run across 4 lanes of a NovaSeq (Illumina), multiplexed with other samples.
-
bioRxiv - Molecular Biology 2022Quote: ... by adding 4 μl of 1× CircLigase II Buffer (Epicentre/Illumina), 2 μl of 50mM of MnCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... puteoserpentis (499ROV/1-4) specimens using short-read (Illumina HiSeq 3000) and long-read (PacBio ...
-
bioRxiv - Microbiology 2023Quote: ... Ribosomal RNA depletion with additional probes recommended by Illumina (Table 4), stranded library preparation (Illumina Ribo-Zero Plus rRNA Depletion w/ Stranded Total RNA) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and NovaSeq 1.5 Xp 4-Lane Kit (Illumina, cat. no. 20043131), samples were sequenced on the NovaSeq 6000 system (Illumina).
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were sequenced (4 samples per Illumina Novaseq SP flow cell) aiming for a minimum 25,000 read pairs per spot ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were subsequently sequenced (2 x 150 bp or 2 x 200 bp paired-end reads) using a MiSeq (Illumina) equipment.
-
bioRxiv - Synthetic Biology 2022Quote: ... using Qiagen RNeasy Plus kit.200ng of extracted RNA was used to produce SARS-CoV-2 amplicon libraries using the NEBNext SARS-CoV-2 FS Library Prep Kit (Illumina) using the VarSkip Short Express Protocol with 25 minutes fragmentation step and 8 cycles of PCR enrichment ...
-
bioRxiv - Immunology 2020Quote: ... using NextSeq 500/550 v2.5 sequencing reagent kit (read length: 2 × 75 bp) or NovaSeq S1 sequencing reagent kit (read length: 2 × 100 bp) (Illumina) respectively ...
-
bioRxiv - Immunology 2020Quote: ... Sequencing was performed in a high-throughput MiSeq machine using either a v2 Nano reagent kit 2×250bp or a v3 reagent kit 2×300bp (Illumina) at the Genomic Research Unit (GRU ...
-
bioRxiv - Genomics 2020Quote: ... Pooled library sizes were selected (2% gel, BluePippin, Sage Science) and sent for 2 × 150-bp deep sequencing (Miseq, Illumina).
-
bioRxiv - Genomics 2021Quote: ... TrueSeq libraries were then sequenced as necessary for their desired length as paired end 2×151 and 2×301 read multiplex runs on MiSeq platform (Illumina) for pre-cursor and mature MAPT isoforms respectively ...
-
bioRxiv - Microbiology 2022Quote: ... and sequenced as 2 × 150 bp reads on the MiSeq sequencing instrument using the MiSeq Micro kit version 2 (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... the library was sequenced on an Illumina MiSeq with a MiSeq Reagent Kit v.2 (2 × 250 bp; Illumina Inc.). A total of 3.27 x 106 paired-end reads were obtained ...
-
bioRxiv - Microbiology 2022Quote: ... was combined with short-read whole-genome sequencing data for the 169 individuals (2×125 bp or 2×150 bp Illumina paired-end sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were sequenced on the Illumina NextSeq550 (2×75bp) (Plateforme Transcriptome, IRMB, Montpellier, France) or NovaSeq 6000 (2×75bp) (Illumina) at the CNAG ...
-
bioRxiv - Cell Biology 2020Quote: ... and 90 bases for Read 2 (Illumina 20012862). A PhiX control library was spiked in at 0.2 to 1% ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end 2×100 bp RNA-sequencing (Illumina TruSeq RNA Library Prep Kit ...
-
bioRxiv - Genomics 2021Quote: ... TruSeq Library Prep (Illumina, RS-122-2001/2), TruSeq Stranded Library Prep (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: ... using NextSeq500 2×75pb (Illumina NextSeq 500 platform) (Sup ...
-
bioRxiv - Cell Biology 2022Quote: ... Paired-end 2×100 bp RNA-sequencing (Illumina TruSeq RNA Library Prep Kit ...
-
bioRxiv - Microbiology 2021Quote: ... and sequencing (2 x 150 bp; Illumina HiSeq3000) at a 4-5 million reads per sample were performed by the Max Planck-Genome Center ...
-
bioRxiv - Genetics 2020Quote: ... 2×150 cycles (Illumina, cat. FC-420-1004), or a Nextseq 500 V2 Mid Output kit ...
-
bioRxiv - Immunology 2021Quote: ... using 2 × 300 bp paired-end kits (Illumina MiSeq Reagent Kit v3 ...
-
bioRxiv - Genomics 2020Quote: ... Paired-end 2×100 bp RNA sequencing (Illumina TruSeq RNA Library Prep Kit ...
-
bioRxiv - Microbiology 2022Quote: ... for 2 × 250 bp paired-end reads (Illumina) for Rm2011 resulting in 4.45 × 106 reads or the MiSeq reagent kit v3 for 2 × 75 bp paired end reads for Rm2011 cya0 resulting in 5.82 × 106 reads ...
-
bioRxiv - Bioengineering 2024Quote: ... 10bp (Index i5) and 90bp (Read 2) (Illumina).
-
bioRxiv - Genetics 2024Quote: ... and sequencing (Illumina HiSeq 2 x 150 bp) of the control sample were completed by GENEWIZ (New Jersey ...
-
bioRxiv - Immunology 2022Quote: ... using MiSeq V3 2 × 300 cycle kit (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... Sequencing (Illumina HiSeq, paired-end, 2×125 bp) was performed by Eurofins Genomics (Ebersberg ...
-
bioRxiv - Neuroscience 2023Quote: ... 2×100 bases paired-end (Novaseq 6000, Illumina).
-
bioRxiv - Genomics 2023Quote: ... and Hi-C (Illumina NovaSeq 6000, 2×150bp) for chromosome-level scaffolding (Fig ...
-
bioRxiv - Microbiology 2024Quote: ... 2×150bp reads (20040534, Illumina, San Diego, CA). RNA sequencing was performed on a NovaSeq X Plus instrument ...
-
bioRxiv - Bioengineering 2024Quote: ... with 2 x 300 bp P2 kits (Illumina). In total ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5’ Illumina adapter (used in the Illumina small RNA kit) and a T7 promoter) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5% v/v TDE1 Tagment DNA Enzyme (Illumina, Cambridge, UK) in nuclease free water (Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 μl of NT buffer (Illumina, FC-121-1030) was added to each tube to neutralize the tagmentation reaction ...
-
bioRxiv - Genomics 2021Quote: ... 5-10% spike-in library (e.g. PhiX control from Illumina) must be added to the lane to balance the nucleotide distribution at the beginning of the forward and reversed reads ...